Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPG11 cdna clone

SPG11 cDNA Clone

Gene Names
SPG11; ALS5; CMT2X; KIAA1840
Synonyms
SPG11; SPG11 cDNA Clone; SPG11 cdna clone
Ordering
For Research Use Only!
Sequence
atgctccggaaaatcttggcctctcagcagcctgaccgatgcaaacgagcccaggccttcatcagcacacagggccttaagccagatactgtggctgaactcgtggcagaagaggtgacacgggagctgcttacttcatcacagggaacaggacataagcagatgttcaacccaacagaggaaagccagacatttcttcagctgaccactctgtgtcaagaccgcacattggtaggcatgaagttgttggataagatttcctccgttccccatggggaactgtcttgcaccacagagctcctgatcctggcccatcattgcttcaccctgacgtgccacatggagggcatcatccgagtcctacaggccgcccacatgctcacagataaccacctggcccccagtgaggagtatgggctggtggtacggctcctcactggcattggaaggtacaacgagatgacatacatatttgatttgctgcataaaaagcactactttgaagtgctaatgaggaagaagttggatccgagtggtaccctgaaaacagccctgctggactacatcaaacgctgccgtcctggagacagtgaaaagcacaatatgattgccctgtgcttcagcatgtgccgggagattggcgagaaccacgaggcagctgcccgcatccaactgaaattgattgagtctcagccctgggaggacagcctcaaggatgggcaccagctgaaacaactgctgctgaaggccctgactctgatgttggatgcagcagagagttatgccaaggactcctgtgtgcgacaggcccagcactgtcagcggctcaccaagttgataactctgcagattcactttctgaacactggccagaacacaatgctcatcaacttgggccgccacaagctgatggactgtattctggccctacctcggttctaccaggcttctattgtggctgaggcctacgattttgttccagattgggctgaaattttataccagcaagtgattcttaaaggagactttaattacttggaagaatttaagcagcaaaggttattaaagtccagtatatttgaagagatttccaaaaaatataaacaacatcagcctactgacatggtcatggaaaacctgaagaaattactcacatattgtgaagatgtttacctgtattacaagttggcatacgaacacaagttttatgaaattgtaaatgtgcttctgaaggaccctcagacaggttgctgtctaaaggacatgctagcaggttag
Sequence Length
1278
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
266,643 Da
NCBI Official Full Name
Homo sapiens spastic paraplegia 11 (autosomal recessive), mRNA
NCBI Official Synonym Full Names
spastic paraplegia 11 (autosomal recessive)
NCBI Official Symbol
SPG11
NCBI Official Synonym Symbols
ALS5; CMT2X; KIAA1840
NCBI Protein Information
spatacsin
UniProt Protein Name
Spatacsin
Protein Family
UniProt Gene Name
SPG11
UniProt Synonym Gene Names
KIAA1840
UniProt Entry Name
SPTCS_HUMAN

NCBI Description

The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

Uniprot Description

SPG11: Defects in SPG11 are the cause of spastic paraplegia autosomal recessive type 11 (SPG11). Spastic paraplegia is a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. Initial symptoms may include difficulty with balance, weakness and stiffness in the legs, muscle spasms, and dragging the toes when walking. In some forms of the disorder, bladder symptoms (such as incontinence) may appear, or the weakness and stiffness may spread to other parts of the body. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 15q14

Cellular Component: cytoplasm; cytoplasmic vesicle; cytosol; lysosomal membrane; nucleolus; plasma membrane; synapse

Molecular Function: protein binding

Biological Process: axon cargo transport; synaptic transmission; synaptic vesicle transport

Disease: Charcot-marie-tooth Disease, Axonal, Type 2x; Spastic Paraplegia 11, Autosomal Recessive

Research Articles on SPG11

Similar Products

Product Notes

The SPG11 spg11 (Catalog #AAA1271540) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctccgga aaatcttggc ctctcagcag cctgaccgat gcaaacgagc ccaggccttc atcagcacac agggccttaa gccagatact gtggctgaac tcgtggcaga agaggtgaca cgggagctgc ttacttcatc acagggaaca ggacataagc agatgttcaa cccaacagag gaaagccaga catttcttca gctgaccact ctgtgtcaag accgcacatt ggtaggcatg aagttgttgg ataagatttc ctccgttccc catggggaac tgtcttgcac cacagagctc ctgatcctgg cccatcattg cttcaccctg acgtgccaca tggagggcat catccgagtc ctacaggccg cccacatgct cacagataac cacctggccc ccagtgagga gtatgggctg gtggtacggc tcctcactgg cattggaagg tacaacgaga tgacatacat atttgatttg ctgcataaaa agcactactt tgaagtgcta atgaggaaga agttggatcc gagtggtacc ctgaaaacag ccctgctgga ctacatcaaa cgctgccgtc ctggagacag tgaaaagcac aatatgattg ccctgtgctt cagcatgtgc cgggagattg gcgagaacca cgaggcagct gcccgcatcc aactgaaatt gattgagtct cagccctggg aggacagcct caaggatggg caccagctga aacaactgct gctgaaggcc ctgactctga tgttggatgc agcagagagt tatgccaagg actcctgtgt gcgacaggcc cagcactgtc agcggctcac caagttgata actctgcaga ttcactttct gaacactggc cagaacacaa tgctcatcaa cttgggccgc cacaagctga tggactgtat tctggcccta cctcggttct accaggcttc tattgtggct gaggcctacg attttgttcc agattgggct gaaattttat accagcaagt gattcttaaa ggagacttta attacttgga agaatttaag cagcaaaggt tattaaagtc cagtatattt gaagagattt ccaaaaaata taaacaacat cagcctactg acatggtcat ggaaaacctg aagaaattac tcacatattg tgaagatgtt tacctgtatt acaagttggc atacgaacac aagttttatg aaattgtaaa tgtgcttctg aaggaccctc agacaggttg ctgtctaaag gacatgctag caggttag. It is sometimes possible for the material contained within the vial of "SPG11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.