Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPANXA1 cdna clone

SPANXA1 cDNA Clone

Gene Names
SPANXA1; NAP-X; SPANX; CT11.1; SPAN-X; SPAN-Xa; SPAN-Xb; SPANX-A
Synonyms
SPANXA1; SPANXA1 cDNA Clone; SPANXA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacaaacaatccagtgccggcggggtgaagaggagcgtcccctgtgattccaacgaggccaacgagatgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaactttaaaagaacatctccagaggaactgttgaatgaccacgcccgagagaacagaatcaaccccctccaaatggaggaggaggaattcatggaaataatggttgaaatacctgcaaagtag
Sequence Length
294
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,038 Da
NCBI Official Full Name
Homo sapiens sperm protein associated with the nucleus, X-linked, family member A1, mRNA
NCBI Official Synonym Full Names
sperm protein associated with the nucleus, X-linked, family member A1
NCBI Official Symbol
SPANXA1
NCBI Official Synonym Symbols
NAP-X; SPANX; CT11.1; SPAN-X; SPAN-Xa; SPAN-Xb; SPANX-A
NCBI Protein Information
sperm protein associated with the nucleus on the X chromosome A
UniProt Protein Name
Sperm protein associated with the nucleus on the X chromosome A
UniProt Gene Name
SPANXA1
UniProt Synonym Gene Names
SPAN-X; SPANX-A
UniProt Entry Name
SPNXA_HUMAN

NCBI Description

Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-head orientation with SPANX family member A2, which appears to be a duplication of the A1 locus. The protein encoded by this gene targets to the nucleus where it associates with nuclear vacuoles and the redundant nuclear envelope. Based on its association with these poorly characterized regions of the sperm nucleus, this protein provides a biochemical marker to study unique structures in spermatazoa while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

SPANXA1: Temporally regulated transcription and translation of several testis-specific genes is required to initiate the series of molecular and morphological changes in the male germ cell lineage necessary for the formation of mature spermatozoa. This gene is a member of the SPANX family of cancer/testis-associated genes, which are located in a cluster on chromosome X. The SPANX genes encode differentially expressed testis-specific proteins that localize to various subcellular compartments. This particular gene maps to chromosome X in a head-to-head orientation with SPANX family member A2, which appears to be a duplication of the A1 locus. The protein encoded by this gene targets to the nucleus where it associates with nuclear vacuoles and the redundant nuclear envelope. Based on its association with these poorly characterized regions of the sperm nucleus, this protein provides a biochemical marker to study unique structures in spermatazoa while attempting to further define its role in spermatogenesis. [provided by RefSeq, Jul 2008]

Protein type: Cancer Testis Antigen (CTA); Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: Xq27.1

Cellular Component: nucleus

Molecular Function: protein binding

Biological Process: spermatogenesis

Research Articles on SPANXA1

Similar Products

Product Notes

The SPANXA1 spanxa1 (Catalog #AAA1278207) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaaac aatccagtgc cggcggggtg aagaggagcg tcccctgtga ttccaacgag gccaacgaga tgatgccgga gaccccaact ggggactcag acccgcaacc tgctcctaaa aaaatgaaaa catctgagtc ctcgaccata ctagtggttc gctacaggag gaactttaaa agaacatctc cagaggaact gttgaatgac cacgcccgag agaacagaat caaccccctc caaatggagg aggaggaatt catggaaata atggttgaaa tacctgcaaa gtag. It is sometimes possible for the material contained within the vial of "SPANXA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.