Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SORBS2 cdna clone

SORBS2 cDNA Clone

Gene Names
SORBS2; ARGBP2; PRO0618
Synonyms
SORBS2; SORBS2 cDNA Clone; SORBS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagttactatcagaggccgttttccccctcggcatattctctcccagcctcactcaactccagcattgtcatgcagcacggcacatccctcgattccacagacacatatccccagcatgcgcagtctctggatggcaccaccagcagctctatccccctgtaccgatcctcagaggaagagaagagagtgacagtcatcaaagccccgcattacccagggatcgggcccgtggatgaatccggaatccccacagcaattagaacgacagtcgaccggcccaaggactggtacaagacgatgtttaagcaaattcacatggtgcacaagccggatgatgacacagacatgtataatactccttatacatacaatgcaggtctgtacaacccaccctacagtgctcagtcacaccctgctgcaaagacccaaacctacagacctctttccaaaagccactccgacaacagccccaatgcctttaaggatgcgtcctccccagtgcctcccccacatgttccacctccagtcccgccgcttcgaccaagagatcggtcttcaacagaaaagcatgactgggatcctccagacagaaaagtggacacaagaaaatttcggtctgagccaaggagtatttttgaatatgaacctggcaagtcatcaattcttcagcatgaaagaccaccccctctcccaacaactccgacacctgttccaagggaacctggccggaagcctctttctagctcccgactcggagaagtcactggtagcccctcccctccgccccggagtggcgcccccacaccaagctcgcgcgccccggctctgtctcccacccggcctcctaaaaagcctctggactatgttcaagatcattcttctggtgttttcaatgaggcctccttgtatcagtcctctatagacagaagcctggaaagacccatgagttctgcaagcatggccagtgacttcaggaagcggaggaagagcgagcctgcagtgggtccaccacggggcttgggagatcaaagtgcgagcaggactagcccaggccgagtggacctcccaggatcaagcaccactcttacaaagtctttcactagctcttctccttcttccccatcaagagcaaaagaccgtgagtcccctagaagttactcatccactttgactgacatggggagaagtgcaccaagggaaagaagaggaactccagaaaaagagaaattgcctgcaaaagctgtttatgattttaaggctcagacatctaaggagttgtcatttaagaaaggagatactgtctacatcctcaggaaaattgatcaaaattggtatgagggagaacaccacgggagagtgggcatcttcccgatctcatacgtagagaaactcacacctcctgagaaagcacagcctgcaagaccacctccgccagcccagcccggagaaatcggagaagctatagccaaatacaacttcaacgcagacacaaatgtggagctgtcactgagaaagggagatagagttattcttcttaaaagagttgatcaaaactggtatgaaggtaaaatcccaggaaccaacagacaaggcatcttccctgtttcctatgtggaggtcgtcaagaagaacacaaaaggtgctgaggactaccctgaccctccaataccccacagctattctagtgataggattcacagcttgagctcaaataagccacagcgtcctgtgtttactcatgaaaatattcaaggtgggggggaaccgtttcaggctctgtataactatactcccaggaatgaagatgagctggagctcagagaaagtgatgtcattgatgtcatggaaaagtgtgatgacggctggtttgtggggacctcaagaagaaccaaattctttggtactttccccggaaactacgtcaagaggctgtga
Sequence Length
1938
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,966 Da
NCBI Official Full Name
Homo sapiens sorbin and SH3 domain containing 2, mRNA
NCBI Official Synonym Full Names
sorbin and SH3 domain containing 2
NCBI Official Symbol
SORBS2
NCBI Official Synonym Symbols
ARGBP2; PRO0618
NCBI Protein Information
sorbin and SH3 domain-containing protein 2
UniProt Protein Name
Sorbin and SH3 domain-containing protein 2
UniProt Gene Name
SORBS2
UniProt Synonym Gene Names
ARGBP2; KIAA0777; ArgBP2
UniProt Entry Name
SRBS2_HUMAN

NCBI Description

Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

ArgBP2: Adapter protein that plays a role in the assembling of signaling complexes, being a link between ABL kinases and actin cytoskeleton. Can form complex with ABL1 and CBL, thus promoting ubiquitination and degradation of ABL1 or with AKT1 and PAK1, thus mediating AKT1-mediated activation of PAK1. Isoform 6 increases water and sodium absorption in the intestine and gall-bladder. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 4q35.1

Cellular Component: actin cytoskeleton

Molecular Function: cytoskeletal adaptor activity; protein binding; structural constituent of cytoskeleton; structural constituent of muscle

Research Articles on SORBS2

Similar Products

Product Notes

The SORBS2 sorbs2 (Catalog #AAA1271733) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttact atcagaggcc gttttccccc tcggcatatt ctctcccagc ctcactcaac tccagcattg tcatgcagca cggcacatcc ctcgattcca cagacacata tccccagcat gcgcagtctc tggatggcac caccagcagc tctatccccc tgtaccgatc ctcagaggaa gagaagagag tgacagtcat caaagccccg cattacccag ggatcgggcc cgtggatgaa tccggaatcc ccacagcaat tagaacgaca gtcgaccggc ccaaggactg gtacaagacg atgtttaagc aaattcacat ggtgcacaag ccggatgatg acacagacat gtataatact ccttatacat acaatgcagg tctgtacaac ccaccctaca gtgctcagtc acaccctgct gcaaagaccc aaacctacag acctctttcc aaaagccact ccgacaacag ccccaatgcc tttaaggatg cgtcctcccc agtgcctccc ccacatgttc cacctccagt cccgccgctt cgaccaagag atcggtcttc aacagaaaag catgactggg atcctccaga cagaaaagtg gacacaagaa aatttcggtc tgagccaagg agtatttttg aatatgaacc tggcaagtca tcaattcttc agcatgaaag accaccccct ctcccaacaa ctccgacacc tgttccaagg gaacctggcc ggaagcctct ttctagctcc cgactcggag aagtcactgg tagcccctcc cctccgcccc ggagtggcgc ccccacacca agctcgcgcg ccccggctct gtctcccacc cggcctccta aaaagcctct ggactatgtt caagatcatt cttctggtgt tttcaatgag gcctccttgt atcagtcctc tatagacaga agcctggaaa gacccatgag ttctgcaagc atggccagtg acttcaggaa gcggaggaag agcgagcctg cagtgggtcc accacggggc ttgggagatc aaagtgcgag caggactagc ccaggccgag tggacctccc aggatcaagc accactctta caaagtcttt cactagctct tctccttctt ccccatcaag agcaaaagac cgtgagtccc ctagaagtta ctcatccact ttgactgaca tggggagaag tgcaccaagg gaaagaagag gaactccaga aaaagagaaa ttgcctgcaa aagctgttta tgattttaag gctcagacat ctaaggagtt gtcatttaag aaaggagata ctgtctacat cctcaggaaa attgatcaaa attggtatga gggagaacac cacgggagag tgggcatctt cccgatctca tacgtagaga aactcacacc tcctgagaaa gcacagcctg caagaccacc tccgccagcc cagcccggag aaatcggaga agctatagcc aaatacaact tcaacgcaga cacaaatgtg gagctgtcac tgagaaaggg agatagagtt attcttctta aaagagttga tcaaaactgg tatgaaggta aaatcccagg aaccaacaga caaggcatct tccctgtttc ctatgtggag gtcgtcaaga agaacacaaa aggtgctgag gactaccctg accctccaat accccacagc tattctagtg ataggattca cagcttgagc tcaaataagc cacagcgtcc tgtgtttact catgaaaata ttcaaggtgg gggggaaccg tttcaggctc tgtataacta tactcccagg aatgaagatg agctggagct cagagaaagt gatgtcattg atgtcatgga aaagtgtgat gacggctggt ttgtggggac ctcaagaaga accaaattct ttggtacttt ccccggaaac tacgtcaaga ggctgtga. It is sometimes possible for the material contained within the vial of "SORBS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.