Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SNAI2 cdna clone

SNAI2 cDNA Clone

Gene Names
SNAI2; SLUG; WS2D; SLUGH1; SNAIL2
Synonyms
SNAI2; SNAI2 cDNA Clone; SNAI2 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgcgctccttcctggtcaagaagcatttcaacgcctccaaaaagccaaactacagcgaactggacacacatacagtgattatttccccgtatctctatgagagttactccatgcctgtcataccacaaccagagatcctcagctcaggagcatacagccccatcactgtgtggactaccgctgctccattccacgcccagctacccaatggcctctctcctctttccggatactcctcatctttggggcgagtgagtccccctcctccatctgacacctcctccaaggaccacagtggctcagaaagccccattagtgatgaagaggaaagactacagtccaagctttcagacccccatgccattgaagctgaaaagtttcagtgcaatttatgcaataagacctattcaactttttctgggctggccaaacataagcagctgcactgcgatgcccagtctagaaaatctttcagctgtaaatactgtgacaaggaatatgtgagcctgggcgccctgaagatgcatattcggacccacacattaccttgtgtttgcaagatctgcggcaaggcgttttccagaccctggttgcttcaaggacacattagaactcacacgggggagaagcctttttcttgccctcactgcaacagagcatttgcagacaggtcaaatctgagggctcatctgcagacccattctgatgtaaagaaataccagtgcaaaaactgctccaaaaccttctccagaatgtctctcctgcacaaacatgaggaatctggctgctgtgtagcacactga
Sequence Length
807
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,986 Da
NCBI Official Full Name
Homo sapiens snail homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
snail family transcriptional repressor 2
NCBI Official Symbol
SNAI2
NCBI Official Synonym Symbols
SLUG; WS2D; SLUGH1; SNAIL2
NCBI Protein Information
zinc finger protein SNAI2
UniProt Protein Name
Zinc finger protein SNAI2
Protein Family
UniProt Gene Name
SNAI2
UniProt Synonym Gene Names
SLUG; SLUGH
UniProt Entry Name
SNAI2_HUMAN

NCBI Description

This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]

Uniprot Description

Snail2: Transcriptional repressor. Involved in the generation and migration of neural crest cells. Plays a role in mediating RAF1-induced transcriptional repression of the TJ protein, occludin (OCLN) and subsequent oncogenic transformation of epithelial cells. Interacts (via SNAG domain) with LIMD1 (via LIM domains), WTIP (via LIM domains) and AJUBA (via LIM domains). Expressed in placenta and adult heart, pancreas, liver, kidney and skeletal muscle. Belongs to the snail C2H2-type zinc-finger protein family.

Protein type: Motility/polarity/chemotaxis; C2H2-type zinc finger protein; Apoptosis; Transcription factor

Chromosomal Location of Human Ortholog: 8q11

Cellular Component: nuclear chromatin; nucleus

Molecular Function: protein binding; sequence-specific DNA binding

Biological Process: epithelial to mesenchymal transition; negative regulation of cell adhesion mediated by integrin; negative regulation of chondrocyte differentiation; negative regulation of DNA damage response, signal transduction by p53 class mediator; negative regulation of transcription from RNA polymerase II promoter; neural crest cell development; Notch signaling pathway; osteoblast differentiation; pigmentation; positive regulation of cell migration; regulation of chemokine production; regulation of osteoblast differentiation; sensory perception of sound; Wnt receptor signaling pathway through beta-catenin

Disease: Piebald Trait; Waardenburg Syndrome, Type 2d

Research Articles on SNAI2

Similar Products

Product Notes

The SNAI2 snai2 (Catalog #AAA1274520) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgcgct ccttcctggt caagaagcat ttcaacgcct ccaaaaagcc aaactacagc gaactggaca cacatacagt gattatttcc ccgtatctct atgagagtta ctccatgcct gtcataccac aaccagagat cctcagctca ggagcataca gccccatcac tgtgtggact accgctgctc cattccacgc ccagctaccc aatggcctct ctcctctttc cggatactcc tcatctttgg ggcgagtgag tccccctcct ccatctgaca cctcctccaa ggaccacagt ggctcagaaa gccccattag tgatgaagag gaaagactac agtccaagct ttcagacccc catgccattg aagctgaaaa gtttcagtgc aatttatgca ataagaccta ttcaactttt tctgggctgg ccaaacataa gcagctgcac tgcgatgccc agtctagaaa atctttcagc tgtaaatact gtgacaagga atatgtgagc ctgggcgccc tgaagatgca tattcggacc cacacattac cttgtgtttg caagatctgc ggcaaggcgt tttccagacc ctggttgctt caaggacaca ttagaactca cacgggggag aagccttttt cttgccctca ctgcaacaga gcatttgcag acaggtcaaa tctgagggct catctgcaga cccattctga tgtaaagaaa taccagtgca aaaactgctc caaaaccttc tccagaatgt ctctcctgca caaacatgag gaatctggct gctgtgtagc acactga. It is sometimes possible for the material contained within the vial of "SNAI2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.