Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMOC1 cdna clone

SMOC1 cDNA Clone

Gene Names
SMOC1; OAS
Synonyms
SMOC1; SMOC1 cDNA Clone; SMOC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcccgcgcgctgcgcccgcctgctcacgccccacttgctgctggtgttggtgcagctgtcccctgctcgcggccaccgcaccacaggccccaggtttctaataagtgaccgtgacccacagtgcaacctccactgctccaggactcaacccaaacccatctgtgcctctgatggcaggtcctacgagtccatgtgtgagtaccagcgagccaagtgccgagacccgaccctgggcgtggtgcatcgaggtagatgcaaagatgctggccagagcaagtgtcgcctggagcgggctcaagccctggagcaagccaagaagcctcaggaagctgtgtttgtcccagagtgtggcgaggatggctcctttacccaggtgcagtgccatacttacactgggtactgctggtgtgtcaccccggatgggaagcccatcagtggctcttctgtgcagaataaaactcctgtatgttcaggttcagtcaccgacaagcccttgagccagggtaactcaggaaggaaagatgacgggtctaagccgacacccacgatggagacccagccggtgttcgatggagatgaaatcacagccccaactctatggattaaacacttggtgatcaaggactccaaactgaacaacaccaacataagaaattcagagaaagtctattcgtgtgaccaggagaggcagagtgccctggaagaggcccagcagaatccccgtgagggtattgtcatccctgaatgtgcccctgggggactctataagccagtgcaatgccaccagtccactggctactgctggtgtgtgctggtggacacagggcgcccgctgcctgggacctccacacgctacgtgatgcccagttgtgagagcgacgccagggccaagactacagaggcggatgaccccttcaaggacagggagctaccaggctgtccagaagggaagaaaatggagtttatcaccagcctactggatgctctcaccactgacatggttcaggccattaactcagcagcgcccactggaggtgggaggttctcagagccagaccccagccacaccctggaggagcgggtagtgcactggtatttcagccagctggacagcaatagcagcaacgacattaacaagcgggagatgaagcccttcaagcgctacgtgaagaagaaagccaagcccaagaaatgtgcccggcgtttcaccgactactgtgacctgaacaaagacaaggtcatttcactgcctgagctgaagggctgcctgggtgttagcaaagaagtaggacgcctcgtctaa
Sequence Length
1308
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,262 Da
NCBI Official Full Name
Homo sapiens SPARC related modular calcium binding 1, mRNA
NCBI Official Synonym Full Names
SPARC related modular calcium binding 1
NCBI Official Symbol
SMOC1
NCBI Official Synonym Symbols
OAS
NCBI Protein Information
SPARC-related modular calcium-binding protein 1
UniProt Protein Name
SPARC-related modular calcium-binding protein 1
UniProt Gene Name
SMOC1
UniProt Synonym Gene Names
SMOC-1
UniProt Entry Name
SMOC1_HUMAN

NCBI Description

This gene encodes a multi-domain secreted protein that may have a critical role in ocular and limb development. Mutations in this gene are associated with microphthalmia and limb anomalies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]

Uniprot Description

SMOC1: Plays essential roles in both eye and limb development. Probale regulator of osteoblast differentiation. Defects in SMOC1 are the cause of ophthalmoacromelic syndrome (OAS). A rare disorder presenting with anophthalmia or microphthalmia and limb anomalies. Limb malformations include fused 4th and 5th metacarpals and short 5th finger in hands, and olygodactyly in foot (four toes). Most patients have bilateral anophthalmia/ microphthalmia, but unilateral abnormality is also noted. Other malformations are rare, but venous or vertebral anomaly was recognized each in single cases. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q24.2

Molecular Function: protein binding

Biological Process: eye development; limb development; regulation of osteoblast differentiation

Disease: Microphthalmia With Limb Anomalies

Research Articles on SMOC1

Similar Products

Product Notes

The SMOC1 smoc1 (Catalog #AAA1266856) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcccg cgcgctgcgc ccgcctgctc acgccccact tgctgctggt gttggtgcag ctgtcccctg ctcgcggcca ccgcaccaca ggccccaggt ttctaataag tgaccgtgac ccacagtgca acctccactg ctccaggact caacccaaac ccatctgtgc ctctgatggc aggtcctacg agtccatgtg tgagtaccag cgagccaagt gccgagaccc gaccctgggc gtggtgcatc gaggtagatg caaagatgct ggccagagca agtgtcgcct ggagcgggct caagccctgg agcaagccaa gaagcctcag gaagctgtgt ttgtcccaga gtgtggcgag gatggctcct ttacccaggt gcagtgccat acttacactg ggtactgctg gtgtgtcacc ccggatggga agcccatcag tggctcttct gtgcagaata aaactcctgt atgttcaggt tcagtcaccg acaagccctt gagccagggt aactcaggaa ggaaagatga cgggtctaag ccgacaccca cgatggagac ccagccggtg ttcgatggag atgaaatcac agccccaact ctatggatta aacacttggt gatcaaggac tccaaactga acaacaccaa cataagaaat tcagagaaag tctattcgtg tgaccaggag aggcagagtg ccctggaaga ggcccagcag aatccccgtg agggtattgt catccctgaa tgtgcccctg ggggactcta taagccagtg caatgccacc agtccactgg ctactgctgg tgtgtgctgg tggacacagg gcgcccgctg cctgggacct ccacacgcta cgtgatgccc agttgtgaga gcgacgccag ggccaagact acagaggcgg atgacccctt caaggacagg gagctaccag gctgtccaga agggaagaaa atggagttta tcaccagcct actggatgct ctcaccactg acatggttca ggccattaac tcagcagcgc ccactggagg tgggaggttc tcagagccag accccagcca caccctggag gagcgggtag tgcactggta tttcagccag ctggacagca atagcagcaa cgacattaac aagcgggaga tgaagccctt caagcgctac gtgaagaaga aagccaagcc caagaaatgt gcccggcgtt tcaccgacta ctgtgacctg aacaaagaca aggtcatttc actgcctgag ctgaagggct gcctgggtgt tagcaaagaa gtaggacgcc tcgtctaa. It is sometimes possible for the material contained within the vial of "SMOC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.