Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMAD9 cdna clone

SMAD9 cDNA Clone

Gene Names
SMAD9; PPH2; MADH6; MADH9; SMAD8; SMAD8A; SMAD8B; SMAD8/9
Synonyms
SMAD9; SMAD9 cDNA Clone; SMAD9 cdna clone
Ordering
For Research Use Only!
Sequence
atgcactccaccacccccatcagctccctcttctccttcaccagccccgcagtgaagagactgctaggctggaagcaaggagatgaagaggaaaagtgggcagagaaggcagtggactctctagtgaagaagttaaagaagaagaagggagccatggacgagctggagagggctctcagctgcccggggcagcccagcaaatgcgtcacgattccccgctccctggacgggcggctgcaggtgtcccaccgcaagggcctgccccatgtgatttactgtcgcgtgtggcgctggccggatctgcagtcccaccacgagctgaagccgctggagtgctgtgagttcccatttggctccaagcagaaagaagtgtgcattaacccttaccactaccgccgggtggagactccagtactgcctcctgtgctcgtgccaagacacagtgaatataacccccagctcagcctcctggccaagttccgcagcgcctccctgcacagtgagccactcatgccacacaacgccacctatcctgactctttccagcagcctccgtgctctgcactccctccctcacccagccacgcgttctcccagtccccgtgcacggccagctaccctcactccccaggaagtccttctgagccagagagtccctatcaacactcagactttcgaccagtttgttacgaggagccccagcactggtgctcggtcgcctactatgaactgaacaaccgagttggggagacattccaggcttcctcccgaagtgtgctcatagatgggttcaccgacccttcaaataacaggaacagattctgtcttggacttctttctaatgtaaacagaaactcaacgatagaaaataccaggagacatataggaaagggtgtgcacttgtactacgtcgggggagaggtgtatgccgagtgcgtgagtgacagcagcatctttgtgcagagccggaactgcaactatcaacacggcttccacccagctaccgtctgcaagatccccagcggctgcagcctcaaggtcttcaacaaccagctcttcgctcagctcctggcccagtcagttcaccacggctttgaagtcgtgtatgaactgaccaagatgtgtactatccggatgagttttgttaagggttggggtgctgagtatcatcgccaggatgtcaccagcaccccctgctggattgagattcatcttcatgggccactgcagtggctggacaaagttctgactcagatgggctctccacataaccccatttcttcagtgtcttaa
Sequence Length
1293
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,640 Da
NCBI Official Full Name
Homo sapiens SMAD family member 9, mRNA
NCBI Official Synonym Full Names
SMAD family member 9
NCBI Official Symbol
SMAD9
NCBI Official Synonym Symbols
PPH2; MADH6; MADH9; SMAD8; SMAD8A; SMAD8B; SMAD8/9
NCBI Protein Information
mothers against decapentaplegic homolog 9
UniProt Protein Name
Mothers against decapentaplegic homolog 9
UniProt Gene Name
SMAD9
UniProt Synonym Gene Names
MADH6; MADH9; MAD homolog 9; Mothers against DPP homolog 9; SMAD 9; Smad9
UniProt Entry Name
SMAD9_HUMAN

NCBI Description

The protein encoded by this gene is a member of the SMAD family, which transduces signals from TGF-beta family members. The encoded protein is activated by bone morphogenetic proteins and interacts with SMAD4. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

Uniprot Description

SMAD9: transcription factor phosphorylated and activated by bone morphogenetic protein receptor kinases. Phosphorylated Smads dimerize with collaborating Smad4 and are translocated into the nucleus, where they regulate transcription of target genes. Participates in a wide range of critical processes including morphogenesis, cell-fate determination, proliferation, differentiation and apoptosis. Two alternatively spliced products have been described.

Protein type: Transcription, coactivator/corepressor; DNA-binding

Chromosomal Location of Human Ortholog: 13q12-q14

Cellular Component: cytoplasm; cytosol; intracellular; nucleoplasm; nucleus

Molecular Function: protein binding; transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity

Biological Process: BMP signaling pathway

Disease: Pulmonary Hypertension, Primary, 2

Research Articles on SMAD9

Similar Products

Product Notes

The SMAD9 smad9 (Catalog #AAA1276345) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcactcca ccacccccat cagctccctc ttctccttca ccagccccgc agtgaagaga ctgctaggct ggaagcaagg agatgaagag gaaaagtggg cagagaaggc agtggactct ctagtgaaga agttaaagaa gaagaaggga gccatggacg agctggagag ggctctcagc tgcccggggc agcccagcaa atgcgtcacg attccccgct ccctggacgg gcggctgcag gtgtcccacc gcaagggcct gccccatgtg atttactgtc gcgtgtggcg ctggccggat ctgcagtccc accacgagct gaagccgctg gagtgctgtg agttcccatt tggctccaag cagaaagaag tgtgcattaa cccttaccac taccgccggg tggagactcc agtactgcct cctgtgctcg tgccaagaca cagtgaatat aacccccagc tcagcctcct ggccaagttc cgcagcgcct ccctgcacag tgagccactc atgccacaca acgccaccta tcctgactct ttccagcagc ctccgtgctc tgcactccct ccctcaccca gccacgcgtt ctcccagtcc ccgtgcacgg ccagctaccc tcactcccca ggaagtcctt ctgagccaga gagtccctat caacactcag actttcgacc agtttgttac gaggagcccc agcactggtg ctcggtcgcc tactatgaac tgaacaaccg agttggggag acattccagg cttcctcccg aagtgtgctc atagatgggt tcaccgaccc ttcaaataac aggaacagat tctgtcttgg acttctttct aatgtaaaca gaaactcaac gatagaaaat accaggagac atataggaaa gggtgtgcac ttgtactacg tcgggggaga ggtgtatgcc gagtgcgtga gtgacagcag catctttgtg cagagccgga actgcaacta tcaacacggc ttccacccag ctaccgtctg caagatcccc agcggctgca gcctcaaggt cttcaacaac cagctcttcg ctcagctcct ggcccagtca gttcaccacg gctttgaagt cgtgtatgaa ctgaccaaga tgtgtactat ccggatgagt tttgttaagg gttggggtgc tgagtatcat cgccaggatg tcaccagcac cccctgctgg attgagattc atcttcatgg gccactgcag tggctggaca aagttctgac tcagatgggc tctccacata accccatttc ttcagtgtct taa. It is sometimes possible for the material contained within the vial of "SMAD9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.