Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SMAD5 cdna clone

SMAD5 cDNA Clone

Gene Names
SMAD5; DWFC; JV5-1; MADH5
Synonyms
SMAD5; SMAD5 cDNA Clone; SMAD5 cdna clone
Ordering
For Research Use Only!
Sequence
atgacgtcaatggccagcttgttttcttttactagtccagcagtaaagcgattgttgggctggaaacaaggtgatgaggaggagaaatgggcagaaaaggcagttgatgctttggtgaagaaactaaaaaagaaaaagggtgccatggaggaactggagaaagccttgagcagtccaggacagccgagtaaatgtgtcactattcccagatctttagatggacgcctgcaggtttctcacagaaaaggcttaccccatgttatatattgtcgtgtttggcgctggccggatttgcagagtcatcatgagctaaagccgttggatatttgtgaatttccttttggatctaagcaaaaagaagtttgtatcaacccataccactataagagagtggagagtccagtcttacctccagtattagtgcctcgtcataatgaattcaatccacaacacagccttctggttcagtttaggaacctgagccacaatgaaccacacatgccacaaaatgccacgtttccagattctttccaccagcccaacaacactccttttcccttatctccaaacagcccttatcccccttctcctgctagcagcacatatcccaactccccagcaagttctggaccaggaagtccatttcagctcccagctgatacgcctcctcctgcctatatgccacctgatgatcagatgggtcaagataattcccagcctatggatacaagcaataatatgattcctcagattatgcccagtatatccagcagggatgttcagcctgttgcctatgaagagcctaaacattggtgttcaatagtctactatgaattaaacaatcgtgttggagaagcttttcatgcatcttctactagtgtgttagtagatggattcacagatccttcaaataacaaaagtagattctgcttgggtttgttgtcaaatgttaatcgtaattcgacaattgaaaacactaggcgacatattggaaaaggtgttcatctgtactatgttggtggagaggtgtatgcggaatgcctcagtgacagcagcatatttgtacagagtaggaactgcaactttcatcatggctttcatcccaccactgtctgtaagattcccagcagctgcagcctcaaaatttttaacaatcaggagtttgctcagcttctggctcaatctgtcaaccatgggtttgaggcagtatatgagctcaccaaaatgtgtaccattcggatgagttttgtcaagggttggggagcagaatatcaccggcaggatgtaaccagcaccccatgttggattgagattcatcttcatgggcctcttcagtggctggataaagtccttactcagatgggctcccctctgaaccccatatcttctgtttcataa
Sequence Length
1398
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,258 Da
NCBI Official Full Name
Homo sapiens SMAD family member 5, mRNA
NCBI Official Synonym Full Names
SMAD family member 5
NCBI Official Symbol
SMAD5
NCBI Official Synonym Symbols
DWFC; JV5-1; MADH5
NCBI Protein Information
mothers against decapentaplegic homolog 5
UniProt Protein Name
Mothers against decapentaplegic homolog 5
UniProt Gene Name
SMAD5
UniProt Synonym Gene Names
MADH5; MAD homolog 5; Mothers against DPP homolog 5; SMAD 5; Smad5; hSmad5
UniProt Entry Name
SMAD5_HUMAN

NCBI Description

The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]

Uniprot Description

SMAD5: transcription factor phosphorylated and activated by bone morphogenetic protein receptor kinases. Phosphorylated Smads dimerize with collaborating Smad4 and are translocated into the nucleus, where they regulate transcription of target genes. Participates in a wide range of critical processes including morphogenesis, cell-fate determination, proliferation, differentiation and apoptosis.

Protein type: Transcription, coactivator/corepressor; DNA-binding

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; protein complex

Molecular Function: protein binding; transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity; ubiquitin protein ligase binding

Biological Process: BMP signaling pathway; embryonic pattern specification

Research Articles on SMAD5

Similar Products

Product Notes

The SMAD5 smad5 (Catalog #AAA1274890) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgtcaa tggccagctt gttttctttt actagtccag cagtaaagcg attgttgggc tggaaacaag gtgatgagga ggagaaatgg gcagaaaagg cagttgatgc tttggtgaag aaactaaaaa agaaaaaggg tgccatggag gaactggaga aagccttgag cagtccagga cagccgagta aatgtgtcac tattcccaga tctttagatg gacgcctgca ggtttctcac agaaaaggct taccccatgt tatatattgt cgtgtttggc gctggccgga tttgcagagt catcatgagc taaagccgtt ggatatttgt gaatttcctt ttggatctaa gcaaaaagaa gtttgtatca acccatacca ctataagaga gtggagagtc cagtcttacc tccagtatta gtgcctcgtc ataatgaatt caatccacaa cacagccttc tggttcagtt taggaacctg agccacaatg aaccacacat gccacaaaat gccacgtttc cagattcttt ccaccagccc aacaacactc cttttccctt atctccaaac agcccttatc ccccttctcc tgctagcagc acatatccca actccccagc aagttctgga ccaggaagtc catttcagct cccagctgat acgcctcctc ctgcctatat gccacctgat gatcagatgg gtcaagataa ttcccagcct atggatacaa gcaataatat gattcctcag attatgccca gtatatccag cagggatgtt cagcctgttg cctatgaaga gcctaaacat tggtgttcaa tagtctacta tgaattaaac aatcgtgttg gagaagcttt tcatgcatct tctactagtg tgttagtaga tggattcaca gatccttcaa ataacaaaag tagattctgc ttgggtttgt tgtcaaatgt taatcgtaat tcgacaattg aaaacactag gcgacatatt ggaaaaggtg ttcatctgta ctatgttggt ggagaggtgt atgcggaatg cctcagtgac agcagcatat ttgtacagag taggaactgc aactttcatc atggctttca tcccaccact gtctgtaaga ttcccagcag ctgcagcctc aaaattttta acaatcagga gtttgctcag cttctggctc aatctgtcaa ccatgggttt gaggcagtat atgagctcac caaaatgtgt accattcgga tgagttttgt caagggttgg ggagcagaat atcaccggca ggatgtaacc agcaccccat gttggattga gattcatctt catgggcctc ttcagtggct ggataaagtc cttactcaga tgggctcccc tctgaacccc atatcttctg tttcataa. It is sometimes possible for the material contained within the vial of "SMAD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.