Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLIT2 cdna clone

SLIT2 cDNA Clone

Gene Names
SLIT2; SLIL3; Slit-2
Synonyms
SLIT2; SLIT2 cDNA Clone; SLIT2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgcggcgttggctggcagatgctgtccctgtcgctggggttagtgctggcgatcctgaacaaggtggcaccgcaggcgtgcccggcgcagtgctcttgctcgggcagcacagtggactgtcacgggctggcgctgcgcagcgtgcccaggaatatcccccgcaacaccgagagactggatttaaatggaaataacatcacaagaattacgaagacagattttgctggtcttagacatctaagagttcttcagcttatggagaataagattagcaccattgaaagaggagcattccaggatcttaaagaactagagagactgcgtttaaacagaaatcaccttcagctgtttcctgagttgctgtttcttgggactgcgaagctatacaggcttgatctcagtgaaaaccaaattcaggcaatcccaaggaaagctttccgtggggcagttgacataaaaaatttgcaactggattacaaccagatcagctgtattgaagatggggcattcagggctctccgggacctggaagtgctcactctcaacaataacaacattactagactttctgtggcaagtttcaaccatatgcctaaacttaggacttttcgactgcattcaaacaacctgtattgtgactgccacctggcctggctctccgactggcttcgccaaaggcctcgggttggtctgtacactcagtgtatgggcccctcccacctgagaggccataatgtagccgaggttcaaaaacgagaatttgtctgcagtggtcaccagtcatttatggctccttcttgtagtgttttgcactgccctgccgcctgtacctgtagcaacaatatcgtagactgtcgtgggaaaggtctcactgagatccccacaaatcttccagagaccatcacagaaatacgtttggaacagaacacaatcaaagtcatccctcctggagctttctcaccatataaaaagcttagacgaattgacctgagcaataatcagatctctgaacttgcaccagatgctttccaaggactacgctctctgaattcacttgtcctctatggaaataaaatcacagaactccccaaaagtttatttgaaggactgttttccttacagctcctattattgaatgccaacaagataaactgccttcgggtagatgcttttcaggatctccacaacttgaaccttctctccctatatgacaacaagcttcagaccatcgccaaggggaccttttcacctcttcgggccattcaaactatgcatttggcccagaacccctttatttgtgactgccatctcaagtggctagcggattatctccataccaacccgattgagaccagtggtgcccgttgcaccagcccccgccgcctggcaaacaaaagaattggacagatcaaaagcaagaaattccgttgttcagctaaagaacagtatttcattccaggtacagaagattatcgatcaaaattaagtggagactgctttgcggatctggcttgccctgaaaagtgtcgctgtgaaggaaccacagtagattgctctaatcaaaagctcaacaaaatcccggagcacattccccagtacactgcagagttgcgtctcaataataatgaatttaccgtgttggaagccacaggaatctttaagaaacttcctcaattacgtaaaataaactttagcaacaataagatcacagatattgaggagggagcatttgaaggagcatctggtgtaaatgaaatacttcttacgagtaatcgtttggaaaatgtgcagcataagatgttcaagggattggaaagcctcaaaactttgatgttgagaagcaatcgaataacctgtgtggggaatgacagtttcataggactcagttctgtgcgtttgctttctttgtatgataatcaaattactacagttgcaccaggggcatttgatactctccattctttatctactctaaacctcttggccaatccttttaactgtaactgctacctggcttggttgggagagtggctgagaaagaagagaattgtcacgggaaatcctagatgtcaaaaaccatacttcctgaaagaaatacccatccaggatgtggccattcaggacttcacttgtgatgacggaaatgatgacaatagttgctccccactttctcgctgtcctactgaatgtacttgcttggatacagtcgtccgatgtagcaacaagggtttgaaggtcttgccgaaaggtattccaagagatgtcacagagttgtatctggatggaaaccaatttacactggttcccaaggaactctccaactacaaacatttaacacttatagacttaagtaacaacagaataagcacgctttctaatcagagcttcagcaacatgacccagctcctcaccttaattcttagttacaaccgtctgagatgtattcctcctcgcacctttgatggattaaagtctcttcgattactttctctacatggaaatgacatttctgttgtgcctgaaggtgctttcaatgatctttctgcattatcacatctagcaattggagccaaccctctttactgtgattgtaacatgcagtggttatccgactgggtgaagtcggaatataaggagcctggaattgctcgttgtgctggtcctggagaaatggcagataaacttttactcacaactccctccaaaaaatttacctgtcaaggtcctgtggatgtcaatattctagctaagtgtaacccctgcctatcaaatccgtgtaaaaatgatggcacatgtaatagtgatccagttgacttttaccgatgcacctgtccatatggtttcaaggggcaggactgtgatgtcccaattcatgcctgcatcagtaacccatgtaaacatggaggaacttgccacttaaaggaaggagaagaagatggattctggtgtatttgtgctgatggatttgaaggagaaaattgtgaagtcaacgttgatgattgtgaagataatgactgtgaaaataattctacatgtgtcgatggcattaataactacacatgcctttgcccacctgagtatacaggtgagttgtgtgaggagaagctggacttctgtgcccaggacctgaacccctgccagcacgattcaaagtgcatcctaactccaaagggattcaaatgtgactgcacaccagggtacgtaggtgaacactgcgacatcgattttgacgactgccaagacaacaagtgtaaaaacggagcccactgcacagatgcagtgaacggctatacgtgcatatgccccgaaggttacagtggcttgttctgtgagttttctccacccatggtcctccctcgtaccagcccctgtgataattttgattgtcagaatggagctcagtgtatcgtcagaataaatgagccaatatgtcagtgtttgcctggctatcagggagaaaagtgtgaaaaattggttagtgtgaattttataaacaaagagtcttatcttcagattccttcagccaaggttcggcctcagacgaacataacacttcagattgccacagatgaagacagcggaatcctcctgtataagggtgacaaagaccatatcgcggtagaactctatcgggggcgtgttcgtgccagctatgacaccggctctcatccagcttctgccatttacagtgtggagacaatcaatgatggaaacttccacattgtggaactacttgccttggatcagagtctctctttgtccgtggatggtgggaaccccaaaatcatcactaacttgtcaaagcagtccactctgaattttgactctccactctatgtaggaggcatgccagggaagagtaacgtggcatctctgcgccaggcccctgggcagaacggaaccagcttccacggctgcatccggaacctttacatcaacagtgagctgcaggacttccagaaggtgccgatgcaaacaggcattttgcctggctgtgagccatgccacaagaaggtgtgtgcccatggcacatgccagcccagcagccaggcaggcttcacctgcgagtgccaggaaggatggatggggcccctctgtgaccaacggaccaatgacccttgccttggaaataaatgcgtacatggcacctgcttgcccatcaatgcgttctcctacagctgtaagtgcttggagggccatggaggtgtcctctgtgatgaagaggaggatctgtttaacccatgccaggcgatcaagtgcaagcatgggaagtgcaggctttcaggtctggggcagccctactgtgaatgcagcagtggatacacgggggacagctgtgatcgagaaatctcttgtcgaggggaaaggataagagattattaccaaaagcagcagggctatgctgcttgccaaacaaccaagaaggtgtcccgattagagtgcagaggtgggtgtgcaggagggcagtgctgtggaccgctgaggagcaagcggcggaaatactctttcgaatgcactgacggctcctcctttgtggacgaggttgagaaagtggtgaagtgcggctgtacgaggtgtgtgtcctaa
Sequence Length
4590
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
168,893 Da
NCBI Official Full Name
Homo sapiens slit homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
slit guidance ligand 2
NCBI Official Symbol
SLIT2
NCBI Official Synonym Symbols
SLIL3; Slit-2
NCBI Protein Information
slit homolog 2 protein
UniProt Protein Name
Slit homolog 2 protein
Protein Family
UniProt Gene Name
SLIT2
UniProt Synonym Gene Names
SLIL3; Slit-2
UniProt Entry Name
SLIT2_HUMAN

NCBI Description

This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Uniprot Description

SLIT2: Thought to act as molecular guidance cue in cellular migration, and function appears to be mediated by interaction with roundabout homolog receptors. During neural development involved in axonal navigation at the ventral midline of the neural tube and projection of axons to different regions. SLIT1 and SLIT2 seem to be essential for midline guidance in the forebrain by acting as repulsive signal preventing inappropriate midline crossing by axons projecting from the olfactory bulb. In spinal chord development may play a role in guiding commissural axons once they reached the floor plate by modulating the response to netrin. In vitro, silences the attractive effect of NTN1 but not its growth- stimulatory effect and silencing requires the formation of a ROBO1-DCC complex. May be implicated in spinal chord midline post- crossing axon repulsion. In vitro, only commissural axons that crossed the midline responded to SLIT2. In the developing visual system appears to function as repellent for retinal ganglion axons by providing a repulsion that directs these axons along their appropriate paths prior to, and after passage through, the optic chiasm. In vitro, collapses and repels retinal ganglion cell growth cones. Seems to play a role in branching and arborization of CNS sensory axons, and in neuronal cell migration. In vitro, Slit homolog 2 protein N-product, but not Slit homolog 2 protein C-product, repels olfactory bulb (OB) but not dorsal root ganglia (DRG) axons, induces OB growth cones collapse and induces branching of DRG axons. Seems to be involved in regulating leukocyte migration. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Extracellular matrix; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4p15.2

Cellular Component: cytoplasm; extracellular region; extracellular space; plasma membrane; proteinaceous extracellular matrix

Molecular Function: GTPase inhibitor activity; heparin binding; identical protein binding; laminin-1 binding; protein binding; protein homodimerization activity; proteoglycan binding; Roundabout binding

Biological Process: axon extension involved in axon guidance; axon guidance; branching morphogenesis of a tube; cell migration during sprouting angiogenesis; cellular response to hormone stimulus; chemorepulsion involved in embryonic olfactory bulb interneuron migration; chemorepulsion involved in postnatal olfactory bulb interneuron migration; corticospinal neuron axon guidance through the spinal cord; induction of negative chemotaxis; motor axon guidance; negative chemotaxis; negative regulation of actin filament polymerization; negative regulation of cell growth; negative regulation of cell migration; negative regulation of leukocyte chemotaxis; negative regulation of protein amino acid phosphorylation; negative regulation of small GTPase mediated signal transduction; negative regulation of smooth muscle cell migration; negative regulation of vascular permeability; positive regulation of apoptosis; positive regulation of axonogenesis; response to cortisol stimulus; retinal ganglion cell axon guidance; ureteric bud development

Research Articles on SLIT2

Similar Products

Product Notes

The SLIT2 slit2 (Catalog #AAA1275991) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgcggcg ttggctggca gatgctgtcc ctgtcgctgg ggttagtgct ggcgatcctg aacaaggtgg caccgcaggc gtgcccggcg cagtgctctt gctcgggcag cacagtggac tgtcacgggc tggcgctgcg cagcgtgccc aggaatatcc cccgcaacac cgagagactg gatttaaatg gaaataacat cacaagaatt acgaagacag attttgctgg tcttagacat ctaagagttc ttcagcttat ggagaataag attagcacca ttgaaagagg agcattccag gatcttaaag aactagagag actgcgttta aacagaaatc accttcagct gtttcctgag ttgctgtttc ttgggactgc gaagctatac aggcttgatc tcagtgaaaa ccaaattcag gcaatcccaa ggaaagcttt ccgtggggca gttgacataa aaaatttgca actggattac aaccagatca gctgtattga agatggggca ttcagggctc tccgggacct ggaagtgctc actctcaaca ataacaacat tactagactt tctgtggcaa gtttcaacca tatgcctaaa cttaggactt ttcgactgca ttcaaacaac ctgtattgtg actgccacct ggcctggctc tccgactggc ttcgccaaag gcctcgggtt ggtctgtaca ctcagtgtat gggcccctcc cacctgagag gccataatgt agccgaggtt caaaaacgag aatttgtctg cagtggtcac cagtcattta tggctccttc ttgtagtgtt ttgcactgcc ctgccgcctg tacctgtagc aacaatatcg tagactgtcg tgggaaaggt ctcactgaga tccccacaaa tcttccagag accatcacag aaatacgttt ggaacagaac acaatcaaag tcatccctcc tggagctttc tcaccatata aaaagcttag acgaattgac ctgagcaata atcagatctc tgaacttgca ccagatgctt tccaaggact acgctctctg aattcacttg tcctctatgg aaataaaatc acagaactcc ccaaaagttt atttgaagga ctgttttcct tacagctcct attattgaat gccaacaaga taaactgcct tcgggtagat gcttttcagg atctccacaa cttgaacctt ctctccctat atgacaacaa gcttcagacc atcgccaagg ggaccttttc acctcttcgg gccattcaaa ctatgcattt ggcccagaac ccctttattt gtgactgcca tctcaagtgg ctagcggatt atctccatac caacccgatt gagaccagtg gtgcccgttg caccagcccc cgccgcctgg caaacaaaag aattggacag atcaaaagca agaaattccg ttgttcagct aaagaacagt atttcattcc aggtacagaa gattatcgat caaaattaag tggagactgc tttgcggatc tggcttgccc tgaaaagtgt cgctgtgaag gaaccacagt agattgctct aatcaaaagc tcaacaaaat cccggagcac attccccagt acactgcaga gttgcgtctc aataataatg aatttaccgt gttggaagcc acaggaatct ttaagaaact tcctcaatta cgtaaaataa actttagcaa caataagatc acagatattg aggagggagc atttgaagga gcatctggtg taaatgaaat acttcttacg agtaatcgtt tggaaaatgt gcagcataag atgttcaagg gattggaaag cctcaaaact ttgatgttga gaagcaatcg aataacctgt gtggggaatg acagtttcat aggactcagt tctgtgcgtt tgctttcttt gtatgataat caaattacta cagttgcacc aggggcattt gatactctcc attctttatc tactctaaac ctcttggcca atccttttaa ctgtaactgc tacctggctt ggttgggaga gtggctgaga aagaagagaa ttgtcacggg aaatcctaga tgtcaaaaac catacttcct gaaagaaata cccatccagg atgtggccat tcaggacttc acttgtgatg acggaaatga tgacaatagt tgctccccac tttctcgctg tcctactgaa tgtacttgct tggatacagt cgtccgatgt agcaacaagg gtttgaaggt cttgccgaaa ggtattccaa gagatgtcac agagttgtat ctggatggaa accaatttac actggttccc aaggaactct ccaactacaa acatttaaca cttatagact taagtaacaa cagaataagc acgctttcta atcagagctt cagcaacatg acccagctcc tcaccttaat tcttagttac aaccgtctga gatgtattcc tcctcgcacc tttgatggat taaagtctct tcgattactt tctctacatg gaaatgacat ttctgttgtg cctgaaggtg ctttcaatga tctttctgca ttatcacatc tagcaattgg agccaaccct ctttactgtg attgtaacat gcagtggtta tccgactggg tgaagtcgga atataaggag cctggaattg ctcgttgtgc tggtcctgga gaaatggcag ataaactttt actcacaact ccctccaaaa aatttacctg tcaaggtcct gtggatgtca atattctagc taagtgtaac ccctgcctat caaatccgtg taaaaatgat ggcacatgta atagtgatcc agttgacttt taccgatgca cctgtccata tggtttcaag gggcaggact gtgatgtccc aattcatgcc tgcatcagta acccatgtaa acatggagga acttgccact taaaggaagg agaagaagat ggattctggt gtatttgtgc tgatggattt gaaggagaaa attgtgaagt caacgttgat gattgtgaag ataatgactg tgaaaataat tctacatgtg tcgatggcat taataactac acatgccttt gcccacctga gtatacaggt gagttgtgtg aggagaagct ggacttctgt gcccaggacc tgaacccctg ccagcacgat tcaaagtgca tcctaactcc aaagggattc aaatgtgact gcacaccagg gtacgtaggt gaacactgcg acatcgattt tgacgactgc caagacaaca agtgtaaaaa cggagcccac tgcacagatg cagtgaacgg ctatacgtgc atatgccccg aaggttacag tggcttgttc tgtgagtttt ctccacccat ggtcctccct cgtaccagcc cctgtgataa ttttgattgt cagaatggag ctcagtgtat cgtcagaata aatgagccaa tatgtcagtg tttgcctggc tatcagggag aaaagtgtga aaaattggtt agtgtgaatt ttataaacaa agagtcttat cttcagattc cttcagccaa ggttcggcct cagacgaaca taacacttca gattgccaca gatgaagaca gcggaatcct cctgtataag ggtgacaaag accatatcgc ggtagaactc tatcgggggc gtgttcgtgc cagctatgac accggctctc atccagcttc tgccatttac agtgtggaga caatcaatga tggaaacttc cacattgtgg aactacttgc cttggatcag agtctctctt tgtccgtgga tggtgggaac cccaaaatca tcactaactt gtcaaagcag tccactctga attttgactc tccactctat gtaggaggca tgccagggaa gagtaacgtg gcatctctgc gccaggcccc tgggcagaac ggaaccagct tccacggctg catccggaac ctttacatca acagtgagct gcaggacttc cagaaggtgc cgatgcaaac aggcattttg cctggctgtg agccatgcca caagaaggtg tgtgcccatg gcacatgcca gcccagcagc caggcaggct tcacctgcga gtgccaggaa ggatggatgg ggcccctctg tgaccaacgg accaatgacc cttgccttgg aaataaatgc gtacatggca cctgcttgcc catcaatgcg ttctcctaca gctgtaagtg cttggagggc catggaggtg tcctctgtga tgaagaggag gatctgttta acccatgcca ggcgatcaag tgcaagcatg ggaagtgcag gctttcaggt ctggggcagc cctactgtga atgcagcagt ggatacacgg gggacagctg tgatcgagaa atctcttgtc gaggggaaag gataagagat tattaccaaa agcagcaggg ctatgctgct tgccaaacaa ccaagaaggt gtcccgatta gagtgcagag gtgggtgtgc aggagggcag tgctgtggac cgctgaggag caagcggcgg aaatactctt tcgaatgcac tgacggctcc tcctttgtgg acgaggttga gaaagtggtg aagtgcggct gtacgaggtg tgtgtcctaa. It is sometimes possible for the material contained within the vial of "SLIT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.