SLC7A6OS cdna clone
SLC7A6OS cDNA Clone
Synonyms
SLC7A6OS; SLC7A6OS cDNA Clone; SLC7A6OS cdna clone
Sequence
atggaggccgccaggaccgctgtactccgggtgaagcggaagcgcagtgcggagccggcggaggctcttgtgctcgcttgtaaacgcctccggagcgacgcggtcgagtcagcggcacagaagacgtcggaggatttggagagagcggcggagaataatgtcttccacttggtggccactgtgtgctcccaggaggaaccagtccagcctctcctgcgggaagttctgcgcccgtcacgggacagccagcagcgtgtccgccgtaatctccgcgcctcggctcgggaggtccggcaggagggccgctaccgggtgctttccagccgccgatccttggggaccacctcgagcggccaggagtccgagtacacgccggggaacccagaagccgccgggaactcgggctttcagttgttagaccttgtccacgaggagggagaacctgaagccgcctctgcaggctcctgcaaaacatctgacccagatgtgatcctctgcaattctgtagagttgatccgtgagcgattgactgtgtctgaggatggaccaggagtcaggcgccaggaagaacaaaaacacgatgactatgtgtatgacatttactacttggagacggccactccaggctggattgagaacatcctctccgtgcagccctacagccaagaatgggagctggtgaatgatgatcaagaaccagaggacatttacgacgatgaagatgacgagaacagtgagaataactggcgcaatgagtacccagaggaggagagcagtgatggagatgaggattccagaggctctgctgactacaacagcctgagtgaggaggaaagaggcagcagcagacagcggatgtggagcaagtaccctctggatgtgcagaaggagttcggctatgacagcccccacgacctggattcagactga
Sequence Length
930
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
35,028 Da
NCBI Official Full Name
Homo sapiens solute carrier family 7, member 6 opposite strand, mRNA
NCBI Official Synonym Full Names
solute carrier family 7 member 6 opposite strand
NCBI Official Symbol
SLC7A6OS
NCBI Protein Information
probable RNA polymerase II nuclear localization protein SLC7A6OS
UniProt Protein Name
Probable RNA polymerase II nuclear localization protein SLC7A6OS
Protein Family
UniProt Gene Name
SLC7A6OS
UniProt Entry Name
S7A6O_HUMAN
Uniprot Description
SLC7A6OS: Directs RNA polymerase II nuclear import. Belongs to the IWR1/SLC7A6OS family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 16q22.1
Research Articles on SLC7A6OS
Similar Products
Product Notes
The SLC7A6OS slc7a6os (Catalog #AAA1273355) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccg ccaggaccgc tgtactccgg gtgaagcgga agcgcagtgc ggagccggcg gaggctcttg tgctcgcttg taaacgcctc cggagcgacg cggtcgagtc agcggcacag aagacgtcgg aggatttgga gagagcggcg gagaataatg tcttccactt ggtggccact gtgtgctccc aggaggaacc agtccagcct ctcctgcggg aagttctgcg cccgtcacgg gacagccagc agcgtgtccg ccgtaatctc cgcgcctcgg ctcgggaggt ccggcaggag ggccgctacc gggtgctttc cagccgccga tccttgggga ccacctcgag cggccaggag tccgagtaca cgccggggaa cccagaagcc gccgggaact cgggctttca gttgttagac cttgtccacg aggagggaga acctgaagcc gcctctgcag gctcctgcaa aacatctgac ccagatgtga tcctctgcaa ttctgtagag ttgatccgtg agcgattgac tgtgtctgag gatggaccag gagtcaggcg ccaggaagaa caaaaacacg atgactatgt gtatgacatt tactacttgg agacggccac tccaggctgg attgagaaca tcctctccgt gcagccctac agccaagaat gggagctggt gaatgatgat caagaaccag aggacattta cgacgatgaa gatgacgaga acagtgagaa taactggcgc aatgagtacc cagaggagga gagcagtgat ggagatgagg attccagagg ctctgctgac tacaacagcc tgagtgagga ggaaagaggc agcagcagac agcggatgtg gagcaagtac cctctggatg tgcagaagga gttcggctat gacagccccc acgacctgga ttcagactga. It is sometimes possible for the material contained within the vial of "SLC7A6OS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
