Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC7A14 cdna clone

SLC7A14 cDNA Clone

Gene Names
SLC7A14; PPP1R142
Synonyms
SLC7A14; SLC7A14 cDNA Clone; SLC7A14 cdna clone
Ordering
For Research Use Only!
Sequence
atgctagagggaactgggaccaccacggcacatggaactaagctagcccaggtactcaccacagtggacctcatctctcttggcgttggcagctgtgtgggcactggcatgtatgtggtctctggcctggtggccaaggaaatggcaggacctggtgtcattgtgtccttcatcattgcagccgtcgcatccatattatcaggcgtctgctatgcagagtttggagttcgagtccccaagaccacaggatctgcctacacctacagctatgtcactgttggggaatttgtggcatttttcattggctggaacctgatcctggagtacctgattggcactgcggccggagccagtgctctgagcagcatgtttgactcactagccaaccacaccatcagccgctggatggcggacagcgtgggaaccctcaatggcctggggaaaggtgaagaatcatacccagaccttctggctctgttgatcgcggtcattgtgaccatcattgttgctctgggggtgaagaattccataggcttcaacaatgttctcaatgtgctgaacctggcagtatgggtgttcatcatgatcgcaggcctcttcttcatcaatgggaaatactgggcggagggccagttcttgccccacggctggtcaggggtgctgcaaggagcagcaacatgcttctacgctttcattggctttgacatcatcgccaccactggagaggaagccaagaatcccaacacgtccatcccttatgctatcactgcctccctggtcatctgcctgacagcatatgtgtctgtgagcgtgatcttaactctgatggtgccatattataccattgacacggaatccccactcatggagatgtttgtggctcatgggttctatgctgccaaattcgtagtggccattgggtcggttgcaggactgacagtcagcttgctggggtccctcttcccgatgccgagggtcatttatgccatggctggtgacgggctccttttcaggttcctggctcacgtcagctcctacacagagacaccagtggtggcctgcatcgtgtcggggttcctggcagcgctcctcgcactgttggtcagcttgagagacctgatagagatgatgtctatcggcacgctcctggcctacaccttggtctctgtctgtgtcttgctccttcgataccaacctgagagtgacattgatggttttgtcaagttcttgtctgaggagcacaccaagaagaaggagggcattctggctgactgtgagaaggaagcttgttctcctgtgagtgagggggatgagttttctggcccagccaccaacacatgtggggccaagaacttaccatccttgggagacaatgagatgctcatagggaaatcagacaagtcaacctacaacgtcaaccaccccaattacggcaccgtggacatgaccacaggcatagaagctgatgaatccgaaaatatttatctcatcaagttaaagaagctgattgggcctcattattacaccatgagaatccggctgggccttccaggcaaaatggaccggcccacagcagcgacggggcacacggtgaccatctgcgtgctcctgctcttcatcctcatgttcatcttctgctccttcatcatctttggttctgactacatctcagagcagagctggtgggccatccttctggttgttctgatggtgctgctgatcagcaccctggtgtttgtgatcctgcagcagccagagaaccccaagaagctgccctacatggccccttgcctcccctttgtgcctgcctttgccatgctggtgaacatctatctcatgctaaagctctccaccatcacatggatccggtttgcggtctggtgctttgtgggtctgctcatttattttggatatggcatctggaacagcaccctggaaatcagcgctcgagaagaggccctgcaccaaagcacgtaccaacgctacgacgtggatgaccccttctcagtggaggagggtttctcctacgccacagagggcgagagccaggaggactggggcgggcccactgaagacaaaggcttctattaccaacagatgtcagatgcgaaggcaaacggccggacaagtagcaaagcgaagagcaaaagcaaacacaaacagaactcagaggccctgattgcaaatgatgagttagattactctccagagtag
Sequence Length
2214
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
84,052 Da
NCBI Official Full Name
Homo sapiens solute carrier family 7 (cationic amino acid transporter, y+ system), member 14, mRNA
NCBI Official Synonym Full Names
solute carrier family 7 member 14
NCBI Official Symbol
SLC7A14
NCBI Official Synonym Symbols
PPP1R142
NCBI Protein Information
probable cationic amino acid transporter
UniProt Protein Name
Probable cationic amino acid transporter
UniProt Gene Name
SLC7A14
UniProt Synonym Gene Names
KIAA1613
UniProt Entry Name
S7A14_HUMAN

NCBI Description

This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]

Uniprot Description

SLC7A14: Belongs to the amino acid-polyamine-organocation (APC) superfamily. Cationic amino acid transporter (CAT) (TC 2.A.3.3) family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3q26.2

Cellular Component: integral to plasma membrane

Molecular Function: antiporter activity; L-amino acid transmembrane transporter activity

Disease: Retinitis Pigmentosa 68

Research Articles on SLC7A14

Similar Products

Product Notes

The SLC7A14 slc7a14 (Catalog #AAA1270387) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctagagg gaactgggac caccacggca catggaacta agctagccca ggtactcacc acagtggacc tcatctctct tggcgttggc agctgtgtgg gcactggcat gtatgtggtc tctggcctgg tggccaagga aatggcagga cctggtgtca ttgtgtcctt catcattgca gccgtcgcat ccatattatc aggcgtctgc tatgcagagt ttggagttcg agtccccaag accacaggat ctgcctacac ctacagctat gtcactgttg gggaatttgt ggcatttttc attggctgga acctgatcct ggagtacctg attggcactg cggccggagc cagtgctctg agcagcatgt ttgactcact agccaaccac accatcagcc gctggatggc ggacagcgtg ggaaccctca atggcctggg gaaaggtgaa gaatcatacc cagaccttct ggctctgttg atcgcggtca ttgtgaccat cattgttgct ctgggggtga agaattccat aggcttcaac aatgttctca atgtgctgaa cctggcagta tgggtgttca tcatgatcgc aggcctcttc ttcatcaatg ggaaatactg ggcggagggc cagttcttgc cccacggctg gtcaggggtg ctgcaaggag cagcaacatg cttctacgct ttcattggct ttgacatcat cgccaccact ggagaggaag ccaagaatcc caacacgtcc atcccttatg ctatcactgc ctccctggtc atctgcctga cagcatatgt gtctgtgagc gtgatcttaa ctctgatggt gccatattat accattgaca cggaatcccc actcatggag atgtttgtgg ctcatgggtt ctatgctgcc aaattcgtag tggccattgg gtcggttgca ggactgacag tcagcttgct ggggtccctc ttcccgatgc cgagggtcat ttatgccatg gctggtgacg ggctcctttt caggttcctg gctcacgtca gctcctacac agagacacca gtggtggcct gcatcgtgtc ggggttcctg gcagcgctcc tcgcactgtt ggtcagcttg agagacctga tagagatgat gtctatcggc acgctcctgg cctacacctt ggtctctgtc tgtgtcttgc tccttcgata ccaacctgag agtgacattg atggttttgt caagttcttg tctgaggagc acaccaagaa gaaggagggc attctggctg actgtgagaa ggaagcttgt tctcctgtga gtgaggggga tgagttttct ggcccagcca ccaacacatg tggggccaag aacttaccat ccttgggaga caatgagatg ctcataggga aatcagacaa gtcaacctac aacgtcaacc accccaatta cggcaccgtg gacatgacca caggcataga agctgatgaa tccgaaaata tttatctcat caagttaaag aagctgattg ggcctcatta ttacaccatg agaatccggc tgggccttcc aggcaaaatg gaccggccca cagcagcgac ggggcacacg gtgaccatct gcgtgctcct gctcttcatc ctcatgttca tcttctgctc cttcatcatc tttggttctg actacatctc agagcagagc tggtgggcca tccttctggt tgttctgatg gtgctgctga tcagcaccct ggtgtttgtg atcctgcagc agccagagaa ccccaagaag ctgccctaca tggccccttg cctccccttt gtgcctgcct ttgccatgct ggtgaacatc tatctcatgc taaagctctc caccatcaca tggatccggt ttgcggtctg gtgctttgtg ggtctgctca tttattttgg atatggcatc tggaacagca ccctggaaat cagcgctcga gaagaggccc tgcaccaaag cacgtaccaa cgctacgacg tggatgaccc cttctcagtg gaggagggtt tctcctacgc cacagagggc gagagccagg aggactgggg cgggcccact gaagacaaag gcttctatta ccaacagatg tcagatgcga aggcaaacgg ccggacaagt agcaaagcga agagcaaaag caaacacaaa cagaactcag aggccctgat tgcaaatgat gagttagatt actctccaga gtag. It is sometimes possible for the material contained within the vial of "SLC7A14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.