Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC7A11 cdna clone

SLC7A11 cDNA Clone

Gene Names
SLC7A11; xCT; CCBR1
Synonyms
SLC7A11; SLC7A11 cDNA Clone; SLC7A11 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcagaaagcctgttgtgtccaccatctccaaaggaggttacctgcagggaaatgttaacgggaggctgccttccctgggcaacaaggagccacctgggcaggagaaagtgcagctgaagaggaaagtcactttactgaggggagtctccattatcattggcaccatcattggagcaggaatcttcatctctcctaagggcgtgctccagaacacgggcagcgtgggcatgtctctgaccatctggacggtgtgtggggtcctgtcactatttggagctttgtcttatgctgaattgggaacaactataaagaaatctggaggtcattacacatatattttggaagtctttggtccattaccagcttttgtacgagtctgggtggaactcctcataatacgccctgcagctactgctgtgatatccctggcatttggacgctacattctggaaccattttttattcaatgtgaaatccctgaacttgcgatcaagctcattacagctgtgggcataactgtagtgatggtcctaaatagcatgagtgtcagctggagcgcccggatccagattttcttaaccttttgcaagctcacagcaattctgataattatagtccctggagttatgcagctaattaaaggtcaaacgcagaactttaaagacgccttttcaggaagagattcaagtattacgcggttgccactggctttttattatggaatgtatgcatatgctggctggttttacctcaactttgttactgaagaagtagaaaaccctgaaaaaaccattccccttgcaatatgtatatccatggccattgtcaccattggctatgtgctgacaaatgtggcctactttacgaccattaatgctgaggagctgctgctttcaaatgcagtggcagtgaccttttctgagcggctactgggaaatttctcattagcagttccgatctttgttgccctctcctgctttggctccatgaacggtggtgtgtttgctgtctccaggttattctatgttgcgtctcgagagggtcaccttccagaaatcctctccatgattcatgtccgcaagcacactcctctaccagctgttattgttttgcaccctttgacaatgataatgctcttctctggagacctcgacagtcttttgaatttcctcagttttgccaggtggctttttattgggctggcagttgctgggctgatttatcttcgatacaaatgcccagatatgcatcgtcctttcaaggtgccactgttcatcccagctttgttttccttcacatgcctcttcatggttgccctttccctctattcggacccatttagtacagggattggcttcgtcatcactctgactggagtccctgcgtattatctctttattatatgggacaagaaacccaggtggtttagaataatgtcagagaaaataaccagaacattacaaataatactggaagttgtaccagaagaagataagttatga
Sequence Length
1506
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,423 Da
NCBI Official Full Name
Homo sapiens solute carrier family 7, (cationic amino acid transporter, y+ system) member 11, mRNA
NCBI Official Synonym Full Names
solute carrier family 7 member 11
NCBI Official Symbol
SLC7A11
NCBI Official Synonym Symbols
xCT; CCBR1
NCBI Protein Information
cystine/glutamate transporter
UniProt Protein Name
Cystine/glutamate transporter
UniProt Gene Name
SLC7A11
UniProt Entry Name
XCT_HUMAN

NCBI Description

This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]

Uniprot Description

SLC7A11: Sodium-independent, high-affinity exchange of anionic amino acids with high specificity for anionic form of cystine and glutamate. Belongs to the amino acid-polyamine-organocation (APC) superfamily. L-type amino acid transporter (LAT) (TC 2.A.3.8) family.

Protein type: Membrane protein, multi-pass; Transporter; Transporter, SLC family; Membrane protein, integral

Chromosomal Location of Human Ortholog: 4q28.3

Cellular Component: cell surface; integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: cystine:glutamate antiporter activity; protein binding

Biological Process: amino acid transport; leukocyte migration; response to toxin

Research Articles on SLC7A11

Similar Products

Product Notes

The SLC7A11 slc7a11 (Catalog #AAA1274438) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcagaa agcctgttgt gtccaccatc tccaaaggag gttacctgca gggaaatgtt aacgggaggc tgccttccct gggcaacaag gagccacctg ggcaggagaa agtgcagctg aagaggaaag tcactttact gaggggagtc tccattatca ttggcaccat cattggagca ggaatcttca tctctcctaa gggcgtgctc cagaacacgg gcagcgtggg catgtctctg accatctgga cggtgtgtgg ggtcctgtca ctatttggag ctttgtctta tgctgaattg ggaacaacta taaagaaatc tggaggtcat tacacatata ttttggaagt ctttggtcca ttaccagctt ttgtacgagt ctgggtggaa ctcctcataa tacgccctgc agctactgct gtgatatccc tggcatttgg acgctacatt ctggaaccat tttttattca atgtgaaatc cctgaacttg cgatcaagct cattacagct gtgggcataa ctgtagtgat ggtcctaaat agcatgagtg tcagctggag cgcccggatc cagattttct taaccttttg caagctcaca gcaattctga taattatagt ccctggagtt atgcagctaa ttaaaggtca aacgcagaac tttaaagacg ccttttcagg aagagattca agtattacgc ggttgccact ggctttttat tatggaatgt atgcatatgc tggctggttt tacctcaact ttgttactga agaagtagaa aaccctgaaa aaaccattcc ccttgcaata tgtatatcca tggccattgt caccattggc tatgtgctga caaatgtggc ctactttacg accattaatg ctgaggagct gctgctttca aatgcagtgg cagtgacctt ttctgagcgg ctactgggaa atttctcatt agcagttccg atctttgttg ccctctcctg ctttggctcc atgaacggtg gtgtgtttgc tgtctccagg ttattctatg ttgcgtctcg agagggtcac cttccagaaa tcctctccat gattcatgtc cgcaagcaca ctcctctacc agctgttatt gttttgcacc ctttgacaat gataatgctc ttctctggag acctcgacag tcttttgaat ttcctcagtt ttgccaggtg gctttttatt gggctggcag ttgctgggct gatttatctt cgatacaaat gcccagatat gcatcgtcct ttcaaggtgc cactgttcat cccagctttg ttttccttca catgcctctt catggttgcc ctttccctct attcggaccc atttagtaca gggattggct tcgtcatcac tctgactgga gtccctgcgt attatctctt tattatatgg gacaagaaac ccaggtggtt tagaataatg tcagagaaaa taaccagaac attacaaata atactggaag ttgtaccaga agaagataag ttatga. It is sometimes possible for the material contained within the vial of "SLC7A11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.