Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC6A8 cdna clone

SLC6A8 cDNA Clone

Gene Names
SLC6A8; CRT; CT1; CRTR; CTR5; CCDS1
Synonyms
SLC6A8; SLC6A8 cDNA Clone; SLC6A8 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaagaagagcgccgagaacggcatctatagcgtgtccggcgacgagaagaagggccccctcatcgcgcccgggcccgacggggccccggccaagggcgacggccccgtgggcctggggacacccggcggccgcctggccgtgccgccgcgcgagacctggacgcgccagatggacttcatcatgtcgtgcgtgggcttcgccgtgggcttgggcaacgtgtggcgcttcccctacctgtgctacaagaacggcggaggtgtgttccttattccctacgtcctgatcgccctggttggaggaatccccattttcttcttagagatctcgctgggccagttcatgaaggccggcagcatcaatgtctggaacatctgtcccctgttcaaaggcctgggctacgcctccatggtgatcgtcttctactgcaacacctactacatcatggtgctggcctggggcttctattacctggtcaagtcctttaccaccacgctgccctgggccacatgtggccacacctggaacactcccgactgcgtggagatcttccgccatgaagactgtgccaatgccagcctggccaacctcacctgtgaccagcttgctgaccgccggtcccctgtcatcgagttctgggagaacaaagtcttgaggctgtctgggggactggaggtgccaggggccctcaactgggaggtgaccctttgtctgctggcctgctgggtgctggtctacttctgtgtctggaagggggtcaaatccacgggaaagatcgtgtacttcactgctacattcccctacgtggtcctggtcgtgctgctggtgcgtggagtgctgctgcctggcgccctggatggcatcatttactatctcaagcctgactggtcaaagctggggtcccctcaggtgtggatagatgcggggacccagattttcttttcttacgccattggcctgggggccctcacagccctgggcagctacaaccgcttcaacaacaactgctacaaggacgccatcatcctggctctcatcaacagtgggaccagcttctttgctggcttcgtggtcttctccatcctgggcttcatggctgcagagcagggcgtgcacatctccaaggtggcagagtcagggccgggcctggccttcatcgcctacccgcgggctgtcacgctgatgccagtggccccactctgggctgccctgttcttcttcatgctgttgctgcttggtctcgacagccagtttgtaggtgtggagggcttcatcaccggcctcctcgacctcctcccggcctcctactacttccgtttccaaagggagatctctgtggccctctgttgtgccctctgctttgtcatcgatctctccatggtgactgatggcgggatgtacgtcttccagctgtttgactactactcggccagcggcaccaccctgctctggcaggccttttgggagtgcgtggtggtggcctgggtgtacggagctgaccgcttcatggacgacattgcctgtatgatcgggtaccgaccttgcccctggatgaaatggtgctggtccttcttcaccccgctggtctgcatgggcatcttcatcttcaacgttgtgtactacgagccgctggtctacaacaacacctacgtgtacccgtggtggggtgaggccatgggctgggccttcgccctgtcctccatgctgtgcgtgccgctgcacctcctgggctgcctcctcagggccaagggcaccatggctgagcgctggcagcacctgacccagcccatctggggcctccaccacttggagtaccgagctcaggacgcagatgtcaggggcctgaccaccctgaccccagtgtccgagagcagcaaggtcgtcgtggtggagagtgtcatgtga
Sequence Length
1908
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,523 Da
NCBI Official Full Name
Homo sapiens solute carrier family 6 (neurotransmitter transporter, creatine), member 8, mRNA
NCBI Official Synonym Full Names
solute carrier family 6 member 8
NCBI Official Symbol
SLC6A8
NCBI Official Synonym Symbols
CRT; CT1; CRTR; CTR5; CCDS1
NCBI Protein Information
sodium- and chloride-dependent creatine transporter 1
UniProt Protein Name
Sodium- and chloride-dependent creatine transporter 1
UniProt Gene Name
SLC6A8
UniProt Synonym Gene Names
CT1; Creatine transporter 1
UniProt Entry Name
SC6A8_HUMAN

NCBI Description

The protein encoded by this gene is a plasma membrane protein whose function is to transport creatine into and out of cells. Defects in this gene can result in X-linked creatine deficiency syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Uniprot Description

SLC6A8: Required for the uptake of creatine in muscles and brain. Defects in SLC6A8 are the cause of X-linked creatine deficiency syndrome (XL-CDS). XL-CDS causes developmental delay, hypotonia, mental retardation, seizures, short stature and midface hypoplasia. Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family. SLC6A8 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transporter; Motility/polarity/chemotaxis; Membrane protein, multi-pass; Transporter, SLC family

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: creatine:sodium symporter activity

Biological Process: creatine metabolic process; creatine transport; muscle contraction; transport

Disease: Cerebral Creatine Deficiency Syndrome 1

Research Articles on SLC6A8

Similar Products

Product Notes

The SLC6A8 slc6a8 (Catalog #AAA1268775) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaaga agagcgccga gaacggcatc tatagcgtgt ccggcgacga gaagaagggc cccctcatcg cgcccgggcc cgacggggcc ccggccaagg gcgacggccc cgtgggcctg gggacacccg gcggccgcct ggccgtgccg ccgcgcgaga cctggacgcg ccagatggac ttcatcatgt cgtgcgtggg cttcgccgtg ggcttgggca acgtgtggcg cttcccctac ctgtgctaca agaacggcgg aggtgtgttc cttattccct acgtcctgat cgccctggtt ggaggaatcc ccattttctt cttagagatc tcgctgggcc agttcatgaa ggccggcagc atcaatgtct ggaacatctg tcccctgttc aaaggcctgg gctacgcctc catggtgatc gtcttctact gcaacaccta ctacatcatg gtgctggcct ggggcttcta ttacctggtc aagtccttta ccaccacgct gccctgggcc acatgtggcc acacctggaa cactcccgac tgcgtggaga tcttccgcca tgaagactgt gccaatgcca gcctggccaa cctcacctgt gaccagcttg ctgaccgccg gtcccctgtc atcgagttct gggagaacaa agtcttgagg ctgtctgggg gactggaggt gccaggggcc ctcaactggg aggtgaccct ttgtctgctg gcctgctggg tgctggtcta cttctgtgtc tggaaggggg tcaaatccac gggaaagatc gtgtacttca ctgctacatt cccctacgtg gtcctggtcg tgctgctggt gcgtggagtg ctgctgcctg gcgccctgga tggcatcatt tactatctca agcctgactg gtcaaagctg gggtcccctc aggtgtggat agatgcgggg acccagattt tcttttctta cgccattggc ctgggggccc tcacagccct gggcagctac aaccgcttca acaacaactg ctacaaggac gccatcatcc tggctctcat caacagtggg accagcttct ttgctggctt cgtggtcttc tccatcctgg gcttcatggc tgcagagcag ggcgtgcaca tctccaaggt ggcagagtca gggccgggcc tggccttcat cgcctacccg cgggctgtca cgctgatgcc agtggcccca ctctgggctg ccctgttctt cttcatgctg ttgctgcttg gtctcgacag ccagtttgta ggtgtggagg gcttcatcac cggcctcctc gacctcctcc cggcctccta ctacttccgt ttccaaaggg agatctctgt ggccctctgt tgtgccctct gctttgtcat cgatctctcc atggtgactg atggcgggat gtacgtcttc cagctgtttg actactactc ggccagcggc accaccctgc tctggcaggc cttttgggag tgcgtggtgg tggcctgggt gtacggagct gaccgcttca tggacgacat tgcctgtatg atcgggtacc gaccttgccc ctggatgaaa tggtgctggt ccttcttcac cccgctggtc tgcatgggca tcttcatctt caacgttgtg tactacgagc cgctggtcta caacaacacc tacgtgtacc cgtggtgggg tgaggccatg ggctgggcct tcgccctgtc ctccatgctg tgcgtgccgc tgcacctcct gggctgcctc ctcagggcca agggcaccat ggctgagcgc tggcagcacc tgacccagcc catctggggc ctccaccact tggagtaccg agctcaggac gcagatgtca ggggcctgac caccctgacc ccagtgtccg agagcagcaa ggtcgtcgtg gtggagagtg tcatgtga. It is sometimes possible for the material contained within the vial of "SLC6A8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.