Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC6A13 cdna clone

SLC6A13 cDNA Clone

Gene Names
SLC6A13; GAT2; GAT3; GAT-2
Synonyms
SLC6A13; SLC6A13 cDNA Clone; SLC6A13 cdna clone
Ordering
For Research Use Only!
Sequence
atggatagcagggtctcaggcacaaccagtaatggagagacaaaaccagtgtatccagtcatggaaaagaaggaggaagatggcaccctggagcgggggcactggaacaacaagatggagtttgtgctgtcagtggctggggagatcattggcttaggcaacgtctggaggtttccctatctctgctacaaaaatgggggaggtgagatgagagcccttgtgccaccccacccactcctggaaggaggatacttccatctcctgcacttacggcccctctggggagtcccatag
Sequence Length
294
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,910 Da
NCBI Official Full Name
Homo sapiens solute carrier family 6 (neurotransmitter transporter, GABA), member 13, mRNA
NCBI Official Synonym Full Names
solute carrier family 6 member 13
NCBI Official Symbol
SLC6A13
NCBI Official Synonym Symbols
GAT2; GAT3; GAT-2
NCBI Protein Information
sodium- and chloride-dependent GABA transporter 2
UniProt Protein Name
Sodium- and chloride-dependent GABA transporter 2
UniProt Gene Name
SLC6A13
UniProt Synonym Gene Names
GAT2; GAT-2
UniProt Entry Name
S6A13_HUMAN

Uniprot Description

SLC6A13: Terminates the action of GABA by its high affinity sodium-dependent reuptake into presynaptic terminals. Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family. SLC6A13 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, SLC family; Membrane protein, integral; Transporter; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 12p13.3

Cellular Component: integral to plasma membrane; neuron projection; plasma membrane

Molecular Function: gamma-aminobutyric acid:sodium symporter activity

Biological Process: gamma-aminobutyric acid transport; neurotransmitter transport; synaptic transmission

Research Articles on SLC6A13

Similar Products

Product Notes

The SLC6A13 slc6a13 (Catalog #AAA1274348) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatagca gggtctcagg cacaaccagt aatggagaga caaaaccagt gtatccagtc atggaaaaga aggaggaaga tggcaccctg gagcgggggc actggaacaa caagatggag tttgtgctgt cagtggctgg ggagatcatt ggcttaggca acgtctggag gtttccctat ctctgctaca aaaatggggg aggtgagatg agagcccttg tgccacccca cccactcctg gaaggaggat acttccatct cctgcactta cggcccctct ggggagtccc atag. It is sometimes possible for the material contained within the vial of "SLC6A13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.