SLC6A12 cdna clone
SLC6A12 cDNA Clone
Gene Names
SLC6A12; BGT1; GAT2; BGT-1
Synonyms
SLC6A12; SLC6A12 cDNA Clone; SLC6A12 cdna clone
Sequence
atggacgggaaggtggcagtgcaagagcgtgggcctcctgcggtctcctgggtccccgaggagggagagaagttggaccaggaagacgaggaccaggtgaaggatcggggccaatggaccaacaagatggagtttgtgctgtcagtggccggggagatcattgggctgggcaatgtctggaggtttccctatctctgctacaaaaacggaggtggagccttcttcatcccctacttcatcttcttctttgtctgcggcatcccggtgttcttcctggaggtggcgttgggccaatacaccagccaagggagtgtcacagcctggaggaagatctgccccctcttccagggcattggtctggcatctgtggtcatcgagtcatatttgaatgtctactacatcatcatccttgcctgggctctcttctacctgttcagctccttcacttctgagctgccctggacgacctgcaacaacttttggaacacagagcattgcacggactttctgaaccactcaggagccggcacagtgaccccatttgagaattttacctcacctgtcatggaattctgggagagacgagttctgggcatcacctcgggcatccatgacctgggctccctgcgctgggagctggccctgtgcctcctgctcgcctgggtcatctgctatttctgcatctggaagggggtcaagtccacaggcaaggtggtttatttcacagccacgtttccgtacctgatgcttgtcattttgctgatcagaggtgtcacccttcccggagcctaccagggcatcatctactacttgaagccagatttgttccgcctcaaggaccctcaggtgtggatggatgcgggcacccagatcttcttctcctttgccatctgccaggggtgcctgacagccctgggcagctacaacaagtatcacaacaactgctacaaggactgcatcgccctctgcttcctgaacagtgccaccagctttgtggctgggtttgttgtcttctccatcctgggcttcatgtcccaagagcaaggggtgcccatttctgaagtggccgagtcaggtcctgggctggccttcatcgccttccccaaggctgtgactatgatgcccttatcccagctgtggtcctgcctgttctttatcatgctcatattcctagggctggacagccagtttgtctgtgtggagtgcctggtgacagcctccatagacatgttccccaggcagctccggaagagcgggcggcgcgagctcctcatcctcaccatcgccgtcatgtgctacctgatagggcttttcctggtcaccgagggcgggatgtacatcttccagctgtttgactactatgcttccagtggcatatgcctgctgttcctgtcattgtttgaagtggtctgcataagctgggtgtatggggcggaccgtttctatgacaacattgaggacatgattggctaccggccatggcccctggtgaagatctcctggctcttcctgacccctggactttgcctggccactttcctcttctccttgagcaagtacacccccctcaagtacaacaacgtctatgtgtacccgccctggggatactccattggctggttcctggctctgtcctccatggtctgtgtcccactcttcgtcgtcatcaccctcctgaagactcggggtcctttcaggaagcgtctgcgtcagctcatcacccctgactccagtctgccacagcccaagcaacatccctgcttggatggcagtgctggccggaactttgggccctccccaacaagggaaggactgatagccggggagaaggagacccatttgtag
Sequence Length
1845
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
69,368 Da
NCBI Official Full Name
Homo sapiens solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12, mRNA
NCBI Official Synonym Full Names
solute carrier family 6 member 12
NCBI Official Symbol
SLC6A12
NCBI Official Synonym Symbols
BGT1; GAT2; BGT-1
NCBI Protein Information
sodium- and chloride-dependent betaine transporter
UniProt Protein Name
Sodium- and chloride-dependent betaine transporter
UniProt Gene Name
SLC6A12
UniProt Entry Name
S6A12_HUMAN
Uniprot Description
SLC6A12: Transports betaine and GABA. May have a role in regulation of GABAergic transmission in the brain through the reuptake of GABA into presynaptic terminals, as well as in osmotic regulation. Belongs to the sodium:neurotransmitter symporter (SNF) (TC 2.A.22) family. SLC6A12 subfamily.
Protein type: Transporter; Transporter, SLC family; Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12p13
Cellular Component: integral to membrane; integral to plasma membrane; neuron projection; plasma membrane
Molecular Function: amino acid transmembrane transporter activity; gamma-aminobutyric acid:sodium symporter activity; protein binding
Biological Process: amino acid transport; gamma-aminobutyric acid transport; neurotransmitter transport; synaptic transmission; transport
Research Articles on SLC6A12
Similar Products
Product Notes
The SLC6A12 slc6a12 (Catalog #AAA1277740) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacggga aggtggcagt gcaagagcgt gggcctcctg cggtctcctg ggtccccgag gagggagaga agttggacca ggaagacgag gaccaggtga aggatcgggg ccaatggacc aacaagatgg agtttgtgct gtcagtggcc ggggagatca ttgggctggg caatgtctgg aggtttccct atctctgcta caaaaacgga ggtggagcct tcttcatccc ctacttcatc ttcttctttg tctgcggcat cccggtgttc ttcctggagg tggcgttggg ccaatacacc agccaaggga gtgtcacagc ctggaggaag atctgccccc tcttccaggg cattggtctg gcatctgtgg tcatcgagtc atatttgaat gtctactaca tcatcatcct tgcctgggct ctcttctacc tgttcagctc cttcacttct gagctgccct ggacgacctg caacaacttt tggaacacag agcattgcac ggactttctg aaccactcag gagccggcac agtgacccca tttgagaatt ttacctcacc tgtcatggaa ttctgggaga gacgagttct gggcatcacc tcgggcatcc atgacctggg ctccctgcgc tgggagctgg ccctgtgcct cctgctcgcc tgggtcatct gctatttctg catctggaag ggggtcaagt ccacaggcaa ggtggtttat ttcacagcca cgtttccgta cctgatgctt gtcattttgc tgatcagagg tgtcaccctt cccggagcct accagggcat catctactac ttgaagccag atttgttccg cctcaaggac cctcaggtgt ggatggatgc gggcacccag atcttcttct cctttgccat ctgccagggg tgcctgacag ccctgggcag ctacaacaag tatcacaaca actgctacaa ggactgcatc gccctctgct tcctgaacag tgccaccagc tttgtggctg ggtttgttgt cttctccatc ctgggcttca tgtcccaaga gcaaggggtg cccatttctg aagtggccga gtcaggtcct gggctggcct tcatcgcctt ccccaaggct gtgactatga tgcccttatc ccagctgtgg tcctgcctgt tctttatcat gctcatattc ctagggctgg acagccagtt tgtctgtgtg gagtgcctgg tgacagcctc catagacatg ttccccaggc agctccggaa gagcgggcgg cgcgagctcc tcatcctcac catcgccgtc atgtgctacc tgatagggct tttcctggtc accgagggcg ggatgtacat cttccagctg tttgactact atgcttccag tggcatatgc ctgctgttcc tgtcattgtt tgaagtggtc tgcataagct gggtgtatgg ggcggaccgt ttctatgaca acattgagga catgattggc taccggccat ggcccctggt gaagatctcc tggctcttcc tgacccctgg actttgcctg gccactttcc tcttctcctt gagcaagtac acccccctca agtacaacaa cgtctatgtg tacccgccct ggggatactc cattggctgg ttcctggctc tgtcctccat ggtctgtgtc ccactcttcg tcgtcatcac cctcctgaag actcggggtc ctttcaggaa gcgtctgcgt cagctcatca cccctgactc cagtctgcca cagcccaagc aacatccctg cttggatggc agtgctggcc ggaactttgg gccctcccca acaagggaag gactgatagc cggggagaag gagacccatt tgtag. It is sometimes possible for the material contained within the vial of "SLC6A12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
