Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC5A11 cdna clone

SLC5A11 cDNA Clone

Gene Names
SLC5A11; KST1; RKST1; SGLT6; SMIT2
Synonyms
SLC5A11; SLC5A11 cDNA Clone; SLC5A11 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgtggtggccagtgggtgcatccttgtttgccagcaatgttggaagtggacatttcattggcctggcagggtcaggtgctgctacgggcatttctgtatcagcttatgaacttaatggcttgttttctgtgctgatgttggcctggatcttcctacccatctacattgctggtcaggtcaccacgatgccagaatacctacggaagcgcttcggtggcatcagaatccccatcatcctggctgtactctacctatttatctacatcttcaccaagatctcggtagacatgtatgcaggtgccatcttcatccagcagtctttgcacctggatctgtacctggccatagttgggctactggccatcactgctgtatacacggttgctggtggcctggctgctgtgatctacacggatgccctgcagacgctgatcatgcttataggagcgctcaccttgatgggctacagtttcgccgcggttggtgggatggaaggactgaaggagaagtacttcttggccctggctagcaaccggagtgagaacagcagctgcgggctgccccgggaagatgccttccatattttccgagatccgctgacatctgatctcccgtggccgggggtcctatttggaatgtccatcccatccctctggtactggtgcacggatcaggtgattgtccagcggactctggctgccaagaacctgtcccatgccaaaggaggtgctctgatggctgcatacctgaaggtgctgcccctcttcataatggtgttccctgggatggtcagccgcatcctcttcccagatcaagtggcctgtgcagatccagagatctgccagaagatctgcagcaacccctcaggctgttcggacattgcgtatcccaaactcgtgctggaactcctgcccacagggctccgtgggctgatgatggctgtgatggtggcggctctcatgtcctccctcacctccatctttaacagtgccagcaccatcttcaccatggacctctggaatcacctccggcctcgggcatctgagaaggagctcatgattgtgggcagggtgtttgtgctgctgctggtcctggtctccatcctctggatccctgtggtccaggccagccagggcggccagctcttcatctatatccggtccatcagctcctacctgcagccgcctgtggcggtggtcttcatcatgggatgtttctggaagaggaccaatgaaaagggtgccttctggggcctgatctcgggcctgctcctgggcttggttaggctggtcctggactttatttacgtgcagcctcgatgcgaccagccagatgagcgcccggtcctggtgaagagcattcactacctctacttctccatgatcctgtccacggtcaccctcatcactgtctccaccgtgagctggttcacagagccaccctccaaggagatggtcagccacctgacctggtttactcgtcacgaccccgtggtccagaaggaacaagcaccaccagcagctcccttgtctcttaccctctctcagaacgggatgccagaggccagcagcagcagcagcgtccagttcgagatggttcaagaaaacacgtctaaaacccacagctgtgacatgaccccaaagcagtccaaagtggtgaaggccatcctgtggctctgtggaatacaggagaagggcaaggaagagctcccggccagagcagaagccatcatagtttccctggaagaaaaccccttggtgaagaccctcctggacgtcaacctcattttctgcgtgagctgcgccatctttatctggggctattttgcttag
Sequence Length
1836
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,098 Da
NCBI Official Full Name
Homo sapiens solute carrier family 5 (sodium/glucose cotransporter), member 11, mRNA
NCBI Official Synonym Full Names
solute carrier family 5 member 11
NCBI Official Symbol
SLC5A11
NCBI Official Synonym Symbols
KST1; RKST1; SGLT6; SMIT2
NCBI Protein Information
sodium/myo-inositol cotransporter 2
UniProt Protein Name
Sodium/myo-inositol cotransporter 2
UniProt Gene Name
SLC5A11
UniProt Synonym Gene Names
Na(+)/myo-inositol cotransporter 2; SMIT2
UniProt Entry Name
SC5AB_HUMAN

NCBI Description

Cotransporters, such as SLC5A11, represent a major class of proteins that make use of ion gradients to drive active transport for the cellular accumulation of nutrients, neurotransmitters, osmolytes, and ions Roll et al. (2002) [PubMed 12039040].[supplied by OMIM, Mar 2008]

Uniprot Description

SLC5A11: Involved in the sodium-dependent cotransport of myo- inositol (MI) with a Na(+):MI stoichiometry of 2:1. Exclusively responsible for apical MI transport and absorption in intestine. Also can transport D-chiro-inositol (DCI) but not L-fructose. Exhibits stereospecific cotransport of both D-glucose and D- xylose. May induce apoptosis through the TNF-alpha, PDCD1 pathway. May play a role in the regulation of MI concentration in serum, involving reabsorption in at least the proximal tubule of the kidney. Belongs to the sodium:solute symporter (SSF) (TC 2.A.21) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral; Transporter, SLC family; Transporter

Chromosomal Location of Human Ortholog: 16p12.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: polyol transmembrane transporter activity; protein binding; symporter activity

Research Articles on SLC5A11

Similar Products

Product Notes

The SLC5A11 slc5a11 (Catalog #AAA1273234) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtggt ggccagtggg tgcatccttg tttgccagca atgttggaag tggacatttc attggcctgg cagggtcagg tgctgctacg ggcatttctg tatcagctta tgaacttaat ggcttgtttt ctgtgctgat gttggcctgg atcttcctac ccatctacat tgctggtcag gtcaccacga tgccagaata cctacggaag cgcttcggtg gcatcagaat ccccatcatc ctggctgtac tctacctatt tatctacatc ttcaccaaga tctcggtaga catgtatgca ggtgccatct tcatccagca gtctttgcac ctggatctgt acctggccat agttgggcta ctggccatca ctgctgtata cacggttgct ggtggcctgg ctgctgtgat ctacacggat gccctgcaga cgctgatcat gcttatagga gcgctcacct tgatgggcta cagtttcgcc gcggttggtg ggatggaagg actgaaggag aagtacttct tggccctggc tagcaaccgg agtgagaaca gcagctgcgg gctgccccgg gaagatgcct tccatatttt ccgagatccg ctgacatctg atctcccgtg gccgggggtc ctatttggaa tgtccatccc atccctctgg tactggtgca cggatcaggt gattgtccag cggactctgg ctgccaagaa cctgtcccat gccaaaggag gtgctctgat ggctgcatac ctgaaggtgc tgcccctctt cataatggtg ttccctggga tggtcagccg catcctcttc ccagatcaag tggcctgtgc agatccagag atctgccaga agatctgcag caacccctca ggctgttcgg acattgcgta tcccaaactc gtgctggaac tcctgcccac agggctccgt gggctgatga tggctgtgat ggtggcggct ctcatgtcct ccctcacctc catctttaac agtgccagca ccatcttcac catggacctc tggaatcacc tccggcctcg ggcatctgag aaggagctca tgattgtggg cagggtgttt gtgctgctgc tggtcctggt ctccatcctc tggatccctg tggtccaggc cagccagggc ggccagctct tcatctatat ccggtccatc agctcctacc tgcagccgcc tgtggcggtg gtcttcatca tgggatgttt ctggaagagg accaatgaaa agggtgcctt ctggggcctg atctcgggcc tgctcctggg cttggttagg ctggtcctgg actttattta cgtgcagcct cgatgcgacc agccagatga gcgcccggtc ctggtgaaga gcattcacta cctctacttc tccatgatcc tgtccacggt caccctcatc actgtctcca ccgtgagctg gttcacagag ccaccctcca aggagatggt cagccacctg acctggttta ctcgtcacga ccccgtggtc cagaaggaac aagcaccacc agcagctccc ttgtctctta ccctctctca gaacgggatg ccagaggcca gcagcagcag cagcgtccag ttcgagatgg ttcaagaaaa cacgtctaaa acccacagct gtgacatgac cccaaagcag tccaaagtgg tgaaggccat cctgtggctc tgtggaatac aggagaaggg caaggaagag ctcccggcca gagcagaagc catcatagtt tccctggaag aaaacccctt ggtgaagacc ctcctggacg tcaacctcat tttctgcgtg agctgcgcca tctttatctg gggctatttt gcttag. It is sometimes possible for the material contained within the vial of "SLC5A11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.