Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC39A7 cdna clone

SLC39A7 cDNA Clone

Gene Names
SLC39A7; KE4; HKE4; ZIP7; RING5; H2-KE4; D6S115E; D6S2244E
Synonyms
SLC39A7; SLC39A7 cDNA Clone; SLC39A7 cdna clone
Ordering
For Research Use Only!
Sequence
atggccagaggcctgggggccccccactgggtggccgtgggactgctgacctgggcgaccttggggcttctggtggctggactcgggggtcatgacgacctgcacgacgatctgcaagaggacttccatggccacagccacaggcactcacatgaagatttccaccatggccacagccatgcccatggccatggccacactcacgagagcatctggcatggacatacccacgatcacgaccatggacattcacatgaggatttacaccatggccatagccatggctactcccatgagagcctctaccacagaggacatggacatgaccatgagcatagccatggaggctatggggagtctggggctccaggcatcaagcaggacctggatgctgtcactctctgggcttatgcactgggggccacagtgctgatctcagcagctccattttttgtcctcttccttatccccgtggagtcgaactctccccggcatcgctctctacttcagatcttgctcagttttgcttccggtgggctcctgggagatgctttcctgcacctcattcctcatgctcttgaacctcattctcaccacactctggagcaacccggacatggacactcccacagtggccagggccccattctgtctgtgggactgtgggttctcagtggaattgttgcctttcttgtcgtggagaaatttgtgagacatgtgaaaggaggacatggtcacagtcatggacatggacacgctcacagtcatacacgtggaagtcatggacatggaagacaagagcgttctaccaaggagaagcagagctcagaggaagaagaaaaggaaacaagaggggttcagaagaggcgaggagggagcacagtacccaaagatgggccagtgagacctcagaacgctgaagaagaaaaaagaggcttagacctgcgtgtgtcggggtacctgaatctggctgctgacttggcacacaacttcactgatggtctggccattggggcttcctttcgagggggccggggactagggatcctgaccacaatgactgtcctgctacatgaagtgccccacgaggtcggagactttgccatcttggtccagtctggctgcagcaaaaagcaggcgatgcgtctgcaactactgacagcagtaggggcactggcaggcacagcctgtgcccttctcactgaaggaggagcagtgggcagtgaaattgcaggtggtgcaggtcctggctgggtcctgccatttactgcaggtggctttatctacgtagcaacagtgtctgtgttgcccgagctgctgagggaggcatcaccattgcaatcacttctggaggtgctggggctgctggggggagttatcatgatggtgctgattgcccaccttgagtga
Sequence Length
1410
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,118 Da
NCBI Official Full Name
Homo sapiens solute carrier family 39 (zinc transporter), member 7, mRNA
NCBI Official Synonym Full Names
solute carrier family 39 member 7
NCBI Official Symbol
SLC39A7
NCBI Official Synonym Symbols
KE4; HKE4; ZIP7; RING5; H2-KE4; D6S115E; D6S2244E
NCBI Protein Information
zinc transporter SLC39A7
UniProt Protein Name
Zinc transporter SLC39A7
Protein Family
UniProt Gene Name
SLC39A7
UniProt Synonym Gene Names
HKE4; RING5; ZIP7
UniProt Entry Name
S39A7_HUMAN

NCBI Description

The protein encoded by this gene transports zinc from the Golgi and endoplasmic reticulum to the cytoplasm. This transport may be important for activation of tyrosine kinases, some of which could be involved in cancer progression. Therefore, modulation of the encoded protein could be useful as a therapeutic agent against cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

SLC39A7: transports zinc from the Golgi and endoplasmic reticulum to the cytoplasm. This transport may be important for activation of tyrosine kinases, some of which could be involved in cancer progression. Therefore, modulation of the encoded protein could be useful as a therapeutic agent against cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2011]

Protein type: Membrane protein, integral; Transporter; Transporter, SLC family; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane; nucleoplasm

Molecular Function: protein binding; zinc ion transmembrane transporter activity

Biological Process: cellular zinc ion homeostasis

Research Articles on SLC39A7

Similar Products

Product Notes

The SLC39A7 slc39a7 (Catalog #AAA1266707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccagag gcctgggggc cccccactgg gtggccgtgg gactgctgac ctgggcgacc ttggggcttc tggtggctgg actcgggggt catgacgacc tgcacgacga tctgcaagag gacttccatg gccacagcca caggcactca catgaagatt tccaccatgg ccacagccat gcccatggcc atggccacac tcacgagagc atctggcatg gacataccca cgatcacgac catggacatt cacatgagga tttacaccat ggccatagcc atggctactc ccatgagagc ctctaccaca gaggacatgg acatgaccat gagcatagcc atggaggcta tggggagtct ggggctccag gcatcaagca ggacctggat gctgtcactc tctgggctta tgcactgggg gccacagtgc tgatctcagc agctccattt tttgtcctct tccttatccc cgtggagtcg aactctcccc ggcatcgctc tctacttcag atcttgctca gttttgcttc cggtgggctc ctgggagatg ctttcctgca cctcattcct catgctcttg aacctcattc tcaccacact ctggagcaac ccggacatgg acactcccac agtggccagg gccccattct gtctgtggga ctgtgggttc tcagtggaat tgttgccttt cttgtcgtgg agaaatttgt gagacatgtg aaaggaggac atggtcacag tcatggacat ggacacgctc acagtcatac acgtggaagt catggacatg gaagacaaga gcgttctacc aaggagaagc agagctcaga ggaagaagaa aaggaaacaa gaggggttca gaagaggcga ggagggagca cagtacccaa agatgggcca gtgagacctc agaacgctga agaagaaaaa agaggcttag acctgcgtgt gtcggggtac ctgaatctgg ctgctgactt ggcacacaac ttcactgatg gtctggccat tggggcttcc tttcgagggg gccggggact agggatcctg accacaatga ctgtcctgct acatgaagtg ccccacgagg tcggagactt tgccatcttg gtccagtctg gctgcagcaa aaagcaggcg atgcgtctgc aactactgac agcagtaggg gcactggcag gcacagcctg tgcccttctc actgaaggag gagcagtggg cagtgaaatt gcaggtggtg caggtcctgg ctgggtcctg ccatttactg caggtggctt tatctacgta gcaacagtgt ctgtgttgcc cgagctgctg agggaggcat caccattgca atcacttctg gaggtgctgg ggctgctggg gggagttatc atgatggtgc tgattgccca ccttgagtga. It is sometimes possible for the material contained within the vial of "SLC39A7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.