Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC38A7 cdna clone

SLC38A7 cDNA Clone

Gene Names
SLC38A7; SNAT7
Synonyms
SLC38A7; SLC38A7 cDNA Clone; SLC38A7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccaggtcagcatcaacaatgactacagcgagtgggacttgagcacggatgccggggagcgggctcggctgctgcagagtccctgtgtggacacagcccccaagagtgagtgggaagcctctcctgggggtctggacagaggcaccacttccacacttggggccatcttcatcgtcgtcaacgcgtgcctgggtgcagggttactcaacttcccagcagccttcagcactgcggggggcgtggcagcaggcatcgcactgcagatgggtatgctggttttcatcatcagtggccttgtcatcctggcctactgctcccaggccagcaatgagaggacctaccaggaggtggtatgggctgtgtgtggcaagctgacaggtgtgctatgtgaggtggccatcgctgtctacacctttggcacctgcattgccttcctaatcatcattggcgaccagcaggacaagattatagctgtgatggcgaaagagccggagggggccagcggcccttggtacacagaccgcaagttcaccatcagcctcactgccttcctcttcatcctgcccctctccatccccagggagattggtttccagaaatatgccagcttcctgagcgtcgtgggtacctggtacgtcacagccatcgttatcatcaagtacatctggccagataaagagatgaccccagggaacatcctgaccaggccggcttcctggatggctgtgttcaatgccatgcccaccatctgcttcggatttcagtgccacgtcagcagtgtgcccgtcttcaacagcatgcagcagcctgaagtgaagacctggggtggagtggtgacagctgccatggtcatagccctcgctgtctacatggggacaggcatctgtggcttcctgacctttggagctgctgtggatcctgacgtgctcctgtcctatccctcggaggacatggccgtggccgttgcccgagccttcatcatcctgagcgtgctcacctcctaccctatcctgcacttctgtgggcgggcggtggtggaaggcctgtggctgcgctaccagggggtgccagtggaggaggacgtggggcgggagcggcggcggcgagtgctgcagacgctggtctggttcctgctcaccctgctgctggcgctcttcatccctgacatcggcaaggtgatctcagtcattggaggcctggccgcctgcttcatcttcgtcttcccagggctgtgcctcattcaagccaaactctctgagatggaagaggtcaaaccagccagctggtgggtgctggtcagctacggagtcctcttggtcaccctgggagccttcatcttcggccagaccacagccaacgccatctttgtggatctcttggcataa
Sequence Length
1389
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,904 Da
NCBI Official Full Name
Homo sapiens solute carrier family 38, member 7, mRNA
NCBI Official Synonym Full Names
solute carrier family 38 member 7
NCBI Official Symbol
SLC38A7
NCBI Official Synonym Symbols
SNAT7
NCBI Protein Information
putative sodium-coupled neutral amino acid transporter 7
UniProt Protein Name
Putative sodium-coupled neutral amino acid transporter 7
UniProt Gene Name
SLC38A7
UniProt Synonym Gene Names
SNAT7
UniProt Entry Name
S38A7_HUMAN

Uniprot Description

SLC38A7: Mediates sodium-dependent transport of amino acids, preferentially L-glutamine. Belongs to the amino acid/polyamine transporter 2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Transporter, SLC family; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 16q21

Cellular Component: axon; cell soma

Molecular Function: L-alanine transmembrane transporter activity; L-amino acid transmembrane transporter activity; L-asparagine transmembrane transporter activity; L-aspartate transmembrane transporter activity; L-glutamate transmembrane transporter activity; L-glutamine transmembrane transporter activity; L-histidine transmembrane transporter activity; L-leucine transmembrane transporter activity; L-methionine transmembrane transporter activity; L-serine transmembrane transporter activity; protein binding

Biological Process: asparagine transport; aspartate transport; L-alanine transport; L-serine transport; sodium ion transport

Similar Products

Product Notes

The SLC38A7 slc38a7 (Catalog #AAA1273384) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagg tcagcatcaa caatgactac agcgagtggg acttgagcac ggatgccggg gagcgggctc ggctgctgca gagtccctgt gtggacacag cccccaagag tgagtgggaa gcctctcctg ggggtctgga cagaggcacc acttccacac ttggggccat cttcatcgtc gtcaacgcgt gcctgggtgc agggttactc aacttcccag cagccttcag cactgcgggg ggcgtggcag caggcatcgc actgcagatg ggtatgctgg ttttcatcat cagtggcctt gtcatcctgg cctactgctc ccaggccagc aatgagagga cctaccagga ggtggtatgg gctgtgtgtg gcaagctgac aggtgtgcta tgtgaggtgg ccatcgctgt ctacaccttt ggcacctgca ttgccttcct aatcatcatt ggcgaccagc aggacaagat tatagctgtg atggcgaaag agccggaggg ggccagcggc ccttggtaca cagaccgcaa gttcaccatc agcctcactg ccttcctctt catcctgccc ctctccatcc ccagggagat tggtttccag aaatatgcca gcttcctgag cgtcgtgggt acctggtacg tcacagccat cgttatcatc aagtacatct ggccagataa agagatgacc ccagggaaca tcctgaccag gccggcttcc tggatggctg tgttcaatgc catgcccacc atctgcttcg gatttcagtg ccacgtcagc agtgtgcccg tcttcaacag catgcagcag cctgaagtga agacctgggg tggagtggtg acagctgcca tggtcatagc cctcgctgtc tacatgggga caggcatctg tggcttcctg acctttggag ctgctgtgga tcctgacgtg ctcctgtcct atccctcgga ggacatggcc gtggccgttg cccgagcctt catcatcctg agcgtgctca cctcctaccc tatcctgcac ttctgtgggc gggcggtggt ggaaggcctg tggctgcgct accagggggt gccagtggag gaggacgtgg ggcgggagcg gcggcggcga gtgctgcaga cgctggtctg gttcctgctc accctgctgc tggcgctctt catccctgac atcggcaagg tgatctcagt cattggaggc ctggccgcct gcttcatctt cgtcttccca gggctgtgcc tcattcaagc caaactctct gagatggaag aggtcaaacc agccagctgg tgggtgctgg tcagctacgg agtcctcttg gtcaccctgg gagccttcat cttcggccag accacagcca acgccatctt tgtggatctc ttggcataa. It is sometimes possible for the material contained within the vial of "SLC38A7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.