SLC37A3 cdna clone
SLC37A3 cDNA Clone
Synonyms
SLC37A3; SLC37A3 cDNA Clone; SLC37A3 cdna clone
Sequence
atggcctggccaaatgtttttcaaagagggtctctgctgtcccagttcagccatcatcatgttgtagtgttcctgctcactttcttcagttattcgttgctccatgcttcacgaaaaacatttagcaatgtcaaagtcagtatctctgagcagtggaccccaagtgcttttaacacgtcagttgagctgcctgtggagatctggagcagcaaccatttgttccccagtgcagagaaagcgactcttttcctcggcacactggataccattttcctcttctcctatgctgtgggcctattcatcagtggcatcgttggggatcggttgaatttgcgatgggttctgtcttttggcatgtgctcttctgcattagtggtgtttgtctttggtgcgctcacagaatggctgcgtttctacaacaaatggctgtactgctgcctgtggattgtgaacggcctgctgcagtccactggttggccctgtgtggttgctgttatgggcaactggtttgggaaagccggacgaggagttgtttttggtctctggagtgcctgtgcttcggtgggcaacattttgggagcgtgcctagcttcttctgttcttcagtatggttatgagtatgcctttctggtgacggcgtctgtgcagtttgctggtgggatcgttatcttctttggactcctggtgtcaccagaagaaattggtctctcgggtattgaggcagaagaaaactttgaagaagactcacacaggccattaattaatggtggtgaaaatgaagacgaatatgagccgaattattcaatccaagatgatagttctgttgcccaagtcaaggcgataagcttctaccaggcatgttgccttcctggagtcataccgtactcactggcctacgcctgcttgaagttagtgaattactccttcttcttctggctccccttttatctgagtaacaacttcggctggaaggaggcggaagccgacaagctgtccatttggtacgacgttggagggatcataggtggaactttgcaaggcttcatctctgatgtactacagaagagagcgccggttcttgccctgagtctgcttctggcagttgggtccctcatcgggtatagtcgttctccaaatgataagtccatcaatgcccttctgatgactgttacaggattttttattggtggaccttctaatatgattagttctgctatttctgcggacttgggtcgccaggagctcatccaaaggagcagtgaagctttggccactgtcacaggaattgtggatggttcggggagcattggagctgcagtgggccagtatttagtgtctctgatccgggacaagctaggatggatgtgggttttctactttttcattctcatgacaagttgtacaattgtgtttatctcgccattaatagtgagggaaatattctctctcgtgctaaggagacaggctcacatattgagggagtga
Sequence Length
1485
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,931 Da
NCBI Official Full Name
Homo sapiens solute carrier family 37 (glycerol-3-phosphate transporter), member 3, mRNA
NCBI Official Synonym Full Names
solute carrier family 37 member 3
NCBI Official Symbol
SLC37A3
NCBI Protein Information
sugar phosphate exchanger 3
UniProt Protein Name
Sugar phosphate exchanger 3
Protein Family
UniProt Gene Name
SLC37A3
UniProt Synonym Gene Names
SPX3
UniProt Entry Name
SPX3_HUMAN
Uniprot Description
SLC37A3: Belongs to the major facilitator superfamily. Organophosphate:Pi antiporter (OPA) (TC 2.A.1.4) family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 7q34
Cellular Component: cytoplasm; integral to endoplasmic reticulum membrane
Molecular Function: transmembrane transporter activity
Biological Process: anion transport; glucose-6-phosphate transport; transmembrane transport
Research Articles on SLC37A3
Similar Products
Product Notes
The SLC37A3 slc37a3 (Catalog #AAA1277994) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctggc caaatgtttt tcaaagaggg tctctgctgt cccagttcag ccatcatcat gttgtagtgt tcctgctcac tttcttcagt tattcgttgc tccatgcttc acgaaaaaca tttagcaatg tcaaagtcag tatctctgag cagtggaccc caagtgcttt taacacgtca gttgagctgc ctgtggagat ctggagcagc aaccatttgt tccccagtgc agagaaagcg actcttttcc tcggcacact ggataccatt ttcctcttct cctatgctgt gggcctattc atcagtggca tcgttgggga tcggttgaat ttgcgatggg ttctgtcttt tggcatgtgc tcttctgcat tagtggtgtt tgtctttggt gcgctcacag aatggctgcg tttctacaac aaatggctgt actgctgcct gtggattgtg aacggcctgc tgcagtccac tggttggccc tgtgtggttg ctgttatggg caactggttt gggaaagccg gacgaggagt tgtttttggt ctctggagtg cctgtgcttc ggtgggcaac attttgggag cgtgcctagc ttcttctgtt cttcagtatg gttatgagta tgcctttctg gtgacggcgt ctgtgcagtt tgctggtggg atcgttatct tctttggact cctggtgtca ccagaagaaa ttggtctctc gggtattgag gcagaagaaa actttgaaga agactcacac aggccattaa ttaatggtgg tgaaaatgaa gacgaatatg agccgaatta ttcaatccaa gatgatagtt ctgttgccca agtcaaggcg ataagcttct accaggcatg ttgccttcct ggagtcatac cgtactcact ggcctacgcc tgcttgaagt tagtgaatta ctccttcttc ttctggctcc ccttttatct gagtaacaac ttcggctgga aggaggcgga agccgacaag ctgtccattt ggtacgacgt tggagggatc ataggtggaa ctttgcaagg cttcatctct gatgtactac agaagagagc gccggttctt gccctgagtc tgcttctggc agttgggtcc ctcatcgggt atagtcgttc tccaaatgat aagtccatca atgcccttct gatgactgtt acaggatttt ttattggtgg accttctaat atgattagtt ctgctatttc tgcggacttg ggtcgccagg agctcatcca aaggagcagt gaagctttgg ccactgtcac aggaattgtg gatggttcgg ggagcattgg agctgcagtg ggccagtatt tagtgtctct gatccgggac aagctaggat ggatgtgggt tttctacttt ttcattctca tgacaagttg tacaattgtg tttatctcgc cattaatagt gagggaaata ttctctctcg tgctaaggag acaggctcac atattgaggg agtga. It is sometimes possible for the material contained within the vial of "SLC37A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
