SLC37A2 cdna clone

SLC37A2 cDNA Clone

Gene Names

SLC37A2; pp11662

Synonyms

SLC37A2; SLC37A2 cDNA Clone; SLC37A2 cdna clone

Ordering
Cat. Num. AAA1273154 For Research Use Only!

Sequence

atgcggtcctccctggctccgggagtctggttcttccgggccttctccagggacagctggttccgaggcctcatcctgctgctgaccttcctaatttacgcctgctatcacatgtccaggaagcctatcagtatcgtcaagagccgtctgcaccagaactgctcggagcagatcaaacccatcaatgatactcacagtctcaatgacaccatgtggtgcagctgggccccatttgacaaggacaactataaggagttactagggggcgtggacaacgccttcctcatcgcctatgccatcggcatgttcatcagtggggtttttggggagcggcttccgctccgttactacctctcagctggaatgctgctcagtggccttttcacctcgctctttggcctgggatatttctggaacatccacgagctctggtactttgtggtcatccaggtctgtaatggactcgtccagaccacaggctggccctctgtggtgacctgtgttggcaactggttcgggaaggggaagcgggggttcatcatgggcatctggaattcccacacatctgtgggcaacatcctgggctccctgatcgccggcatctgggtgaacgggcagtggggcctgtcgttcatcgtgcctggcatcattactgccgtcatgggcgtcatcaccttcctcttcctcatcgaacacccagaagatgtggactgcgcccctcctcagcaccacggtgagccagctgagaaccaggacaaccctgaggaccctgggaacagtccctgctctatcagggagagcggccttgagactgtggccaaatgctccaaggggccatgcgaagagcctgctgccatcagcttctttggggcgctccggatcccaggcgtggtcgagttctctctgtgtctgctgtttgccaagctggtcagttacaccttcctctactggctgcccctctacatcgccaatgtggctcactttagtgccaaggaggctggggacctgtctacactcttcgatgttggtggcatcataggcggcatcgtggcagggctcgtctctgactacaccaatggcagggccaccacttgctgtgtcatgctcatcttggctgcccccatgatgttcctgtacaactacattggccaggacgggattgccagctccatagtgatgctgatcatctgtgggggcctggtcaatggcccatacgcgctcatcaccactgctgtctctgctgacctggggactcacaagagcctgaagggcaacgccaaagccctgtccacggtcacggccatcattgacggcaccggctccataggtgcggctctggggcctctgctggctgggctcatctcccccacgggctggaacaatgtcttctacatgctcatctctgccgacgtcctagcctgcttgctcctttgccggttagtatacaaagagatcttggcctggaaggtgtccctgagcagaggcagcggctctagtatggtcctaacccaccagtga

Sequence Length

1518

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

30802202

NCBI GeneID

219855

Molecular Weight

13,154 Da

NCBI Official Full Name

Homo sapiens solute carrier family 37 (glycerol-3-phosphate transporter), member 2, mRNA

NCBI Official Synonym Full Names

solute carrier family 37 member 2

NCBI Official Symbol

SLC37A2

NCBI Official Synonym Symbols

pp11662

NCBI Protein Information

glucose-6-phosphate exchanger SLC37A2

UniProt Protein Name

Glucose-6-phosphate exchanger SLC37A2

Protein Family

Glucose-6-phosphate exchanger

UniProt Gene Name

SLC37A2

UniProt Entry Name

G6PT3_HUMAN

Uniprot Description

SLC37A2: Belongs to the major facilitator superfamily. Organophosphate:Pi antiporter (OPA) (TC 2.A.1.4) family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transporter, SLC family; Transporter; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: integral to endoplasmic reticulum membrane

Biological Process: glucose-6-phosphate transport

Research Articles on SLC37A2

1. Data show that SLC37A1 and SLC37A2 are endoplasmic reticulum associated, P(i)-linked antiporters, that can transport glucose-6-phosphate.

Similar Products

Product Notes

The SLC37A2 slc37a2 (Catalog #AAA1273154) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggtcct ccctggctcc gggagtctgg ttcttccggg ccttctccag ggacagctgg ttccgaggcc tcatcctgct gctgaccttc ctaatttacg cctgctatca catgtccagg aagcctatca gtatcgtcaa gagccgtctg caccagaact gctcggagca gatcaaaccc atcaatgata ctcacagtct caatgacacc atgtggtgca gctgggcccc atttgacaag gacaactata aggagttact agggggcgtg gacaacgcct tcctcatcgc ctatgccatc ggcatgttca tcagtggggt ttttggggag cggcttccgc tccgttacta cctctcagct ggaatgctgc tcagtggcct tttcacctcg ctctttggcc tgggatattt ctggaacatc cacgagctct ggtactttgt ggtcatccag gtctgtaatg gactcgtcca gaccacaggc tggccctctg tggtgacctg tgttggcaac tggttcggga aggggaagcg ggggttcatc atgggcatct ggaattccca cacatctgtg ggcaacatcc tgggctccct gatcgccggc atctgggtga acgggcagtg gggcctgtcg ttcatcgtgc ctggcatcat tactgccgtc atgggcgtca tcaccttcct cttcctcatc gaacacccag aagatgtgga ctgcgcccct cctcagcacc acggtgagcc agctgagaac caggacaacc ctgaggaccc tgggaacagt ccctgctcta tcagggagag cggccttgag actgtggcca aatgctccaa ggggccatgc gaagagcctg ctgccatcag cttctttggg gcgctccgga tcccaggcgt ggtcgagttc tctctgtgtc tgctgtttgc caagctggtc agttacacct tcctctactg gctgcccctc tacatcgcca atgtggctca ctttagtgcc aaggaggctg gggacctgtc tacactcttc gatgttggtg gcatcatagg cggcatcgtg gcagggctcg tctctgacta caccaatggc agggccacca cttgctgtgt catgctcatc ttggctgccc ccatgatgtt cctgtacaac tacattggcc aggacgggat tgccagctcc atagtgatgc tgatcatctg tgggggcctg gtcaatggcc catacgcgct catcaccact gctgtctctg ctgacctggg gactcacaag agcctgaagg gcaacgccaa agccctgtcc acggtcacgg ccatcattga cggcaccggc tccataggtg cggctctggg gcctctgctg gctgggctca tctcccccac gggctggaac aatgtcttct acatgctcat ctctgccgac gtcctagcct gcttgctcct ttgccggtta gtatacaaag agatcttggc ctggaaggtg tccctgagca gaggcagcgg ctctagtatg gtcctaaccc accagtga. It is sometimes possible for the material contained within the vial of "SLC37A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

SLC37A2 cdna clone