SLC36A4 cdna clone
SLC36A4 cDNA Clone
Gene Names
SLC36A4; PAT4
Synonyms
SLC36A4; SLC36A4 cDNA Clone; SLC36A4 cdna clone
Sequence
atggaagcggcggcgacgccggcggctgccggggcggcgaggcgcgaggagctagatatggatgtaatgaggcccttgataaatgagcagaattttgatgggacatcagatgaagaacatgagcaagagcttctgcctgttcagaagcattaccaacttgatgatcaagagggcatttcatttgtacaaactcttatgcaccttcttaaaggaaatattggaactggccttttaggacttccattggcaataaaaaatgcaggcatagtgcttggaccaatcagccttgtgtttataggaattatttctgttcactgtatgcacatattggtacgttgcagtcactttctatgtctgaggtttaaaaagtcaacattaggttatagtgacactgtgagctttgctatggaagtgagtccttggagttgtcttcagaagcaagcagcatgggggcggagtgtggttgacttttttctggtgataacacagctgggattctgtagtgtttatattgtcttcttagctgaaaatgtgaaacaagttcatgaaggattcctggagagtaaagtgtttatttcaaatagtaccaattcatcaaacccttgtgagagaagaagtgttgacataaggatatatatgctttgctttcttccatttataattcttttggtcttcattcgtgaactaaagaatctatttgtactttcattccttgccaacgtttccatggctgtcagtcttgtgataatttaccagtatgttgtcaggaacatgccagatccccacaaccttccaatagtggctggttggaagaaatacccactcttttttggtactgctgtatttgcttttgaaggcataggagtggtccttccactggaaaaccaaatgaaagaatcaaagcgtttccctcaagcgttgaatattggcatggggattgttacaactttgtatgtaacattagctactttaggatatatgtgtttccatgatgaaatcaaaggcagcataactttaaatcttccccaagatgtatggttatatcaatcagtgaaaattctatattcgtttggcatttttgtgacatattcaattcagttctatgttccagcagagatcattatccatgggatcacatccaaatttcatactaaatggaagcaaatctgtgaatttgggataagatccttcttggttagtattacttgtgccggagcaattcttattcctcgtttagacattgtgatttccttcgttggagctgtgagcagcagcacattggccataatcctgccacctttggttgaaattcttacattttcgaaggaacattataatatatggatggtcctgaaaaatatttctatagcattcactggagttgttggcttcttattaggtacatatataactgttgaagaaattatttatcctactcccaaagttgtagctggcactccacagagtccttttctaaatttgaattcaacatgcttaacatctggtttgaaatag
Sequence Length
1515
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,385 Da
NCBI Official Full Name
Homo sapiens solute carrier family 36 (proton/amino acid symporter), member 4, mRNA
NCBI Official Synonym Full Names
solute carrier family 36 member 4
NCBI Official Symbol
SLC36A4
NCBI Official Synonym Symbols
PAT4
NCBI Protein Information
proton-coupled amino acid transporter 4
UniProt Protein Name
Proton-coupled amino acid transporter 4
Protein Family
UniProt Gene Name
SLC36A4
UniProt Synonym Gene Names
PAT4; Proton/amino acid transporter 4
UniProt Entry Name
S36A4_HUMAN
NCBI Description
SLC36A4 belongs to the SLC36 family of amino acid transporters based on sequence similarity with other family members (e.g., SLC36A1; MIM 606561). SLC36 proteins contain about 500 amino acids and have 9 to 11 transmembrane domains. Unlike other SLC36 family members, which are proton-coupled amino acid transporters, SLC36A4 is a high-affinity/low-capacity non-proton-coupled amino acid transporter (Pillai and Meredith, 2011 [PubMed 21097500]).[supplied by OMIM, Feb 2011]
Uniprot Description
SLC36A4: Functions as a sodium-independent electroneutral transporter for tryptophan, proline and alanine. Inhibited by sarcosine. Belongs to the amino acid/polyamine transporter 2 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 11q21
Molecular Function: L-alanine transmembrane transporter activity; L-proline transmembrane transporter activity; L-tryptophan transmembrane transporter activity
Biological Process: L-alanine transport; proline transport; tryptophan transport
Research Articles on SLC36A4
Similar Products
Product Notes
The SLC36A4 slc36a4 (Catalog #AAA1273172) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcgg cggcgacgcc ggcggctgcc ggggcggcga ggcgcgagga gctagatatg gatgtaatga ggcccttgat aaatgagcag aattttgatg ggacatcaga tgaagaacat gagcaagagc ttctgcctgt tcagaagcat taccaacttg atgatcaaga gggcatttca tttgtacaaa ctcttatgca ccttcttaaa ggaaatattg gaactggcct tttaggactt ccattggcaa taaaaaatgc aggcatagtg cttggaccaa tcagccttgt gtttatagga attatttctg ttcactgtat gcacatattg gtacgttgca gtcactttct atgtctgagg tttaaaaagt caacattagg ttatagtgac actgtgagct ttgctatgga agtgagtcct tggagttgtc ttcagaagca agcagcatgg gggcggagtg tggttgactt ttttctggtg ataacacagc tgggattctg tagtgtttat attgtcttct tagctgaaaa tgtgaaacaa gttcatgaag gattcctgga gagtaaagtg tttatttcaa atagtaccaa ttcatcaaac ccttgtgaga gaagaagtgt tgacataagg atatatatgc tttgctttct tccatttata attcttttgg tcttcattcg tgaactaaag aatctatttg tactttcatt ccttgccaac gtttccatgg ctgtcagtct tgtgataatt taccagtatg ttgtcaggaa catgccagat ccccacaacc ttccaatagt ggctggttgg aagaaatacc cactcttttt tggtactgct gtatttgctt ttgaaggcat aggagtggtc cttccactgg aaaaccaaat gaaagaatca aagcgtttcc ctcaagcgtt gaatattggc atggggattg ttacaacttt gtatgtaaca ttagctactt taggatatat gtgtttccat gatgaaatca aaggcagcat aactttaaat cttccccaag atgtatggtt atatcaatca gtgaaaattc tatattcgtt tggcattttt gtgacatatt caattcagtt ctatgttcca gcagagatca ttatccatgg gatcacatcc aaatttcata ctaaatggaa gcaaatctgt gaatttggga taagatcctt cttggttagt attacttgtg ccggagcaat tcttattcct cgtttagaca ttgtgatttc cttcgttgga gctgtgagca gcagcacatt ggccataatc ctgccacctt tggttgaaat tcttacattt tcgaaggaac attataatat atggatggtc ctgaaaaata tttctatagc attcactgga gttgttggct tcttattagg tacatatata actgttgaag aaattattta tcctactccc aaagttgtag ctggcactcc acagagtcct tttctaaatt tgaattcaac atgcttaaca tctggtttga aatag. It is sometimes possible for the material contained within the vial of "SLC36A4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
