Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC35D2 cdna clone

SLC35D2 cDNA Clone

Gene Names
SLC35D2; hfrc; HFRC1; SQV7L; UGTrel8
Synonyms
SLC35D2; SLC35D2 cDNA Clone; SLC35D2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacggccggcggccaggccgaggccgagggcgctggcggggagcccggcgcggcgcggctgccctcgcgggtggcccggctgctgtcggcgctcttctacgggacctgctccttcctcatcgtgcttgtcaacaaggcgctgctgaccacctacggtttcccgtcaccaattttccttggaattggacagatggcagccaccataatgatactatatgtgtccaagctaaacaaaatcattcacttccctgattttgataagaaaattcctgtaaagctgtttcctctgcctctcctctacgttggaaaccacataagtggattatcaagcacaagtaaattaagcctaccgatgttcaccgtgctcaggaaattcaccattccacttaccttacttctggaaaccatcatacttgggaagcagtattcactcaacatcatcctcagtgtctttgccattattctcggggctttcatagcagctgggtctgaccttgcttttaacttagaaggctatatttttgtattcctgaatgatatcttcacagcagcaaatggagtttataccaaacagaaaatggacccaaaggagctagggaaatacggagtacttttctacaatgcctgcttcatgattatcccaactcttattattagtgtctccactggagacctgcaacaggctactgaattcaaccaatggaagaatgttgtgtttatcctacagtttcttctttcctgttttttggggtttctgctgatgtactccacggttctgtgcagctattacaattcagccctgacgacagcagtggttggagccatcaagaatgtatccgttgcctacattgggatattaatcggtggagactacattttctctttgttaaactttgtagggttaaatatttgcatggcagggggcttgagatattcctttttaacactgagcagccagttaaaacctaaacctgtgggtgaagaaaacatctgtttggatttgaagagctaa
Sequence Length
1014
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,702 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35, member D2, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member D2
NCBI Official Symbol
SLC35D2
NCBI Official Synonym Symbols
hfrc; HFRC1; SQV7L; UGTrel8
NCBI Protein Information
UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose transporter
UniProt Protein Name
UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose transporter
UniProt Gene Name
SLC35D2
UniProt Synonym Gene Names
HFRC; UGTREL8; HFRC1; SQV7L; UGTrel8
UniProt Entry Name
S35D2_HUMAN

NCBI Description

Nucleotide sugars, which are synthesized in the cytosol or the nucleus, are high-energy donor substrates for glycosyltransferases located in the lumen of the endoplasmic reticulum and Golgi apparatus. Translocation of nucleotide sugars from the cytosol into the lumen compartment is mediated by specific nucleotide sugar transporters, such as SLC35D2 (Suda et al., 2004 [PubMed 15082721]).[supplied by OMIM, Mar 2008]

Uniprot Description

SLC35D2: Antiporter transporting nucleotide sugars such as UDP-N- acetylglucosamine (UDP-GlcNAc), UDP-glucose (UDP-Glc) and GDP- mannose (GDP-Man) pooled in the cytosol into the lumen of the Golgi in exchange for the corresponding nucleosides monophosphates (UMP for UDP-sugars and GMP for GDP-sugars). May take part in heparan sulfate synthesis by supplying UDP-Glc-NAc, the donor substrate, and thus be involved in growth factor signaling. Belongs to the TPT transporter family. SLC35D subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter; Membrane protein, integral; Membrane protein, multi-pass; Transporter, SLC family

Chromosomal Location of Human Ortholog: 9q22.32

Cellular Component: Golgi membrane

Molecular Function: nucleotide-sugar transmembrane transporter activity; pyrimidine nucleotide sugar transmembrane transporter activity

Biological Process: glycosaminoglycan biosynthetic process; keratan sulfate biosynthetic process

Research Articles on SLC35D2

Similar Products

Product Notes

The SLC35D2 slc35d2 (Catalog #AAA1278713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggccg gcggccaggc cgaggccgag ggcgctggcg gggagcccgg cgcggcgcgg ctgccctcgc gggtggcccg gctgctgtcg gcgctcttct acgggacctg ctccttcctc atcgtgcttg tcaacaaggc gctgctgacc acctacggtt tcccgtcacc aattttcctt ggaattggac agatggcagc caccataatg atactatatg tgtccaagct aaacaaaatc attcacttcc ctgattttga taagaaaatt cctgtaaagc tgtttcctct gcctctcctc tacgttggaa accacataag tggattatca agcacaagta aattaagcct accgatgttc accgtgctca ggaaattcac cattccactt accttacttc tggaaaccat catacttggg aagcagtatt cactcaacat catcctcagt gtctttgcca ttattctcgg ggctttcata gcagctgggt ctgaccttgc ttttaactta gaaggctata tttttgtatt cctgaatgat atcttcacag cagcaaatgg agtttatacc aaacagaaaa tggacccaaa ggagctaggg aaatacggag tacttttcta caatgcctgc ttcatgatta tcccaactct tattattagt gtctccactg gagacctgca acaggctact gaattcaacc aatggaagaa tgttgtgttt atcctacagt ttcttctttc ctgttttttg gggtttctgc tgatgtactc cacggttctg tgcagctatt acaattcagc cctgacgaca gcagtggttg gagccatcaa gaatgtatcc gttgcctaca ttgggatatt aatcggtgga gactacattt tctctttgtt aaactttgta gggttaaata tttgcatggc agggggcttg agatattcct ttttaacact gagcagccag ttaaaaccta aacctgtggg tgaagaaaac atctgtttgg atttgaagag ctaa. It is sometimes possible for the material contained within the vial of "SLC35D2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.