Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC35B2 cdna clone

SLC35B2 cDNA Clone

Gene Names
SLC35B2; SLL; PAPST1; UGTrel4
Synonyms
SLC35B2; SLC35B2 cDNA Clone; SLC35B2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacgccagatggtgggcagtggtggtgctggctgcgttcccctccctaggggcaggtggggagactcccgaagcccctccggagtcatggacccagctatggttcttccgatttgtggtgaatgctgctggctatgccagctttatggtacctggctacctcctggtgcagtacttcaggcggaagaactacctggagaccggtaggggcctctgctttcccctggtgaaagcttgtgtgtttggcaatgagcccaaggcctctgatgaggttcccctggcgccccgaacagaggcggcagagaccaccccgatgtggcaggccctgaaactgctcttctgtgccacagggctccaggtgtcttatctgacttggggtgtgctgcaggaaagagtgatgacccgcagctatggggccacagccacatcaccgggtgagcgctttacggactcgcagttcctggtgctaatgaaccgagtgctggcactgattgtggctggcctctcctgtgttctctgcaagcagccccggcatggggcacccatgtaccggtactcctttgccagcctgtccaatgtgcttagcagctggtgccaatacgaagctcttaagttcgtcagcttccccacccaggtgctggccaaggcctctaaggtgatccctgtcatgctgatgggaaagcttgtgtctcggcgcagctacgaacactgggagtacctgacagccaccctcatctccattggggtcagcatgtttctgctatccagcggaccagagccccgcagctccccagccaccacactctcaggcctcatcttactggcaggttatattgcttttgacagcttcacctcaaactggcaggatgccctgtttgcctataagatgtcatcggtgcagatgatgtttggggtcaatttcttctcctgcctcttcacagtgggctcactgctagaacagggggccctactggagggaacccgcttcatggggcgacacagtgagtttgctgcccatgccctgctactctccatctgctccgcatgtggccagctcttcatcttttacaccattgggcagtttggggctgccgtcttcaccatcatcatgaccctccgccaggcctttgccatccttctttcctgccttctctatggccacactgtcactgtggtgggagggctgggggtggctgtggtctttgctgccctcctgctcagagtctacgcgcggggccgtctaaagcaacggggaaagaaggctgtgcctgttgagtctcctgtgcagaaggtttga
Sequence Length
1299
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,664 Da
NCBI Official Full Name
Homo sapiens solute carrier family 35, member B2, mRNA
NCBI Official Synonym Full Names
solute carrier family 35 member B2
NCBI Official Symbol
SLC35B2
NCBI Official Synonym Symbols
SLL; PAPST1; UGTrel4
NCBI Protein Information
adenosine 3'-phospho 5'-phosphosulfate transporter 1
UniProt Protein Name
Adenosine 3'-phospho 5'-phosphosulfate transporter 1
UniProt Gene Name
SLC35B2
UniProt Synonym Gene Names
PAPST1
UniProt Entry Name
S35B2_HUMAN

NCBI Description

Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]

Uniprot Description

SLC35B2: Mediates the transport of adenosine 3'-phospho 5'- phosphosulfate (PAPS), from cytosol into Golgi. PAPS is a universal sulfuryl donor for sulfation events that take place in the Golgi. May indirectly participate in activation of the NF- kappa-B and MAPK pathways. Belongs to the nucleotide-sugar transporter family. SLC35B subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Transporter, SLC family; Transporter; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.1

Cellular Component: Golgi apparatus; Golgi membrane; integral to endoplasmic reticulum membrane; integral to Golgi membrane; membrane

Molecular Function: 3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity; signal transducer activity

Biological Process: 3'-phosphoadenosine 5'-phosphosulfate biosynthetic process; 3'-phosphoadenosine 5'-phosphosulfate transport; positive regulation of I-kappaB kinase/NF-kappaB cascade

Research Articles on SLC35B2

Similar Products

Product Notes

The SLC35B2 slc35b2 (Catalog #AAA1273123) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgcca gatggtgggc agtggtggtg ctggctgcgt tcccctccct aggggcaggt ggggagactc ccgaagcccc tccggagtca tggacccagc tatggttctt ccgatttgtg gtgaatgctg ctggctatgc cagctttatg gtacctggct acctcctggt gcagtacttc aggcggaaga actacctgga gaccggtagg ggcctctgct ttcccctggt gaaagcttgt gtgtttggca atgagcccaa ggcctctgat gaggttcccc tggcgccccg aacagaggcg gcagagacca ccccgatgtg gcaggccctg aaactgctct tctgtgccac agggctccag gtgtcttatc tgacttgggg tgtgctgcag gaaagagtga tgacccgcag ctatggggcc acagccacat caccgggtga gcgctttacg gactcgcagt tcctggtgct aatgaaccga gtgctggcac tgattgtggc tggcctctcc tgtgttctct gcaagcagcc ccggcatggg gcacccatgt accggtactc ctttgccagc ctgtccaatg tgcttagcag ctggtgccaa tacgaagctc ttaagttcgt cagcttcccc acccaggtgc tggccaaggc ctctaaggtg atccctgtca tgctgatggg aaagcttgtg tctcggcgca gctacgaaca ctgggagtac ctgacagcca ccctcatctc cattggggtc agcatgtttc tgctatccag cggaccagag ccccgcagct ccccagccac cacactctca ggcctcatct tactggcagg ttatattgct tttgacagct tcacctcaaa ctggcaggat gccctgtttg cctataagat gtcatcggtg cagatgatgt ttggggtcaa tttcttctcc tgcctcttca cagtgggctc actgctagaa cagggggccc tactggaggg aacccgcttc atggggcgac acagtgagtt tgctgcccat gccctgctac tctccatctg ctccgcatgt ggccagctct tcatctttta caccattggg cagtttgggg ctgccgtctt caccatcatc atgaccctcc gccaggcctt tgccatcctt ctttcctgcc ttctctatgg ccacactgtc actgtggtgg gagggctggg ggtggctgtg gtctttgctg ccctcctgct cagagtctac gcgcggggcc gtctaaagca acggggaaag aaggctgtgc ctgttgagtc tcctgtgcag aaggtttga. It is sometimes possible for the material contained within the vial of "SLC35B2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.