Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC30A8 cdna clone

SLC30A8 cDNA Clone

Gene Names
SLC30A8; ZNT8; ZnT-8
Synonyms
SLC30A8; SLC30A8 cDNA Clone; SLC30A8 cdna clone
Ordering
For Research Use Only!
Sequence
atgtaccactgccacagtggctccaagcccacagaaaagggggcgaatgagtacgcctatgccaagtggaaactctgttctgcttcagcaatatgcttcattttcatgattgcagaggtcgtgggtgggcacattgctgggagtcttgctgttgtcacagatgctgcccacctcttaattgacctgaccagtttcctgctcagtctcttctccctgtggttgtcatcgaagcctccctctaagcggctgacatttggatggcaccgagcagagatccttggtgccctgctctccatcctgtgcatctgggtggtgactggcgtgctagtgtacctggcatgtgagcgcctgctgtatcctgattaccagatccaggcgactgtgatgatcatcgtttccagctgcgcagtggcggccaacattgtactaactgtggttttgcaccagagatgccttggccacaatcacaaggaagtacaagccaatgccagcgtcagagctgcttttgtgcatgcccttggagatctatttcagagtatcagtgtgctaattagtgcacttattatctactttaagccagagtataaaatagccgacccaatctgcacattcatcttttccatcctggtcttggccagcaccatcactatcttaaaggacttctccatcttactcatggaaggtgtgccaaagagcctgaattacagtggtgtgaaagagcttattttagcagtcgacggggtgctgtctgtgcacagcctgcacatctggtctctaacaatgaatcaagtaattctctcagctcatgttgctacagcagccagccgggacagccaagtggttcggagagaaattgctaaagcccttagcaaaagctttacgatgcactcactcaccattcagatggaatctccagttgaccaggaccccgactgccttttctgtgaagacccctgtgactag
Sequence Length
963
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,053 Da
NCBI Official Full Name
Homo sapiens solute carrier family 30 (zinc transporter), member 8, mRNA
NCBI Official Synonym Full Names
solute carrier family 30 member 8
NCBI Official Symbol
SLC30A8
NCBI Official Synonym Symbols
ZNT8; ZnT-8
NCBI Protein Information
zinc transporter 8
UniProt Protein Name
Zinc transporter 8
Protein Family
UniProt Gene Name
SLC30A8
UniProt Synonym Gene Names
ZNT8; ZnT-8
UniProt Entry Name
ZNT8_HUMAN

NCBI Description

The protein encoded by this gene is a zinc efflux transporter involved in the accumulation of zinc in intracellular vesicles. This gene is expressed at a high level only in the pancreas, particularly in islets of Langerhans. The encoded protein colocalizes with insulin in the secretory pathway granules of the insulin-secreting INS-1 cells. Allelic variants of this gene exist that confer susceptibility to diabetes mellitus, noninsulin-dependent (NIDDM). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]

Uniprot Description

SLC30A8: Facilitates the accumulation of zinc from the cytoplasm into intracellular vesicles, being a zinc-efflux transporter. May be a major component for providing zinc to insulin maturation and/or storage processes in insulin-secreting pancreatic beta- cells. Belongs to the cation diffusion facilitator (CDF) transporter (TC 2.A.4) family. SLC30A subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Transporter; Vesicle; Transporter, SLC family; Membrane protein, integral

Chromosomal Location of Human Ortholog: 8q24.11

Cellular Component: cytoplasmic membrane-bound vesicle; Golgi apparatus; plasma membrane; secretory granule; secretory granule membrane

Molecular Function: protein binding; protein homodimerization activity; zinc ion binding; zinc ion transmembrane transporter activity

Biological Process: cellular zinc ion homeostasis; glucose homeostasis; insulin secretion; positive regulation of insulin secretion; response to glucose stimulus; response to zinc ion; sequestering of zinc ion; zinc ion transport

Disease: Diabetes Mellitus, Noninsulin-dependent

Research Articles on SLC30A8

Similar Products

Product Notes

The SLC30A8 slc30a8 (Catalog #AAA1272019) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtaccact gccacagtgg ctccaagccc acagaaaagg gggcgaatga gtacgcctat gccaagtgga aactctgttc tgcttcagca atatgcttca ttttcatgat tgcagaggtc gtgggtgggc acattgctgg gagtcttgct gttgtcacag atgctgccca cctcttaatt gacctgacca gtttcctgct cagtctcttc tccctgtggt tgtcatcgaa gcctccctct aagcggctga catttggatg gcaccgagca gagatccttg gtgccctgct ctccatcctg tgcatctggg tggtgactgg cgtgctagtg tacctggcat gtgagcgcct gctgtatcct gattaccaga tccaggcgac tgtgatgatc atcgtttcca gctgcgcagt ggcggccaac attgtactaa ctgtggtttt gcaccagaga tgccttggcc acaatcacaa ggaagtacaa gccaatgcca gcgtcagagc tgcttttgtg catgcccttg gagatctatt tcagagtatc agtgtgctaa ttagtgcact tattatctac tttaagccag agtataaaat agccgaccca atctgcacat tcatcttttc catcctggtc ttggccagca ccatcactat cttaaaggac ttctccatct tactcatgga aggtgtgcca aagagcctga attacagtgg tgtgaaagag cttattttag cagtcgacgg ggtgctgtct gtgcacagcc tgcacatctg gtctctaaca atgaatcaag taattctctc agctcatgtt gctacagcag ccagccggga cagccaagtg gttcggagag aaattgctaa agcccttagc aaaagcttta cgatgcactc actcaccatt cagatggaat ctccagttga ccaggacccc gactgccttt tctgtgaaga cccctgtgac tag. It is sometimes possible for the material contained within the vial of "SLC30A8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.