Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC2A4 cdna clone

SLC2A4 cDNA Clone

Gene Names
SLC2A4; GLUT4
Synonyms
SLC2A4; SLC2A4 cDNA Clone; SLC2A4 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgtcgggcttccaacagataggctccgaagatggggaaccccctcagcagcgagtgactgggaccctggtccttgctgtgttctctgcggtgcttggctccctgcagtttgggtacaacattggggtcatcaatgcccctcagaaggtgattgaacagagctacaatgagacgtggctggggaggcaggggcctgagggacccagctccatccctccaggcaccctcaccaccctctgggccctctccgtggccatcttttccgtgggcggcatgatttcctccttcctcattggtatcatctctcagtggcttggaaggaaaagggccatgctggtcaacaatgtcctggcggtgctggggggcagcctcatgggcctggccaacgctgctgcctcctatgaaatgctcatccttggacgattcctcattggcgcctactcagggctgacatcagggctggtgcccatgtacgtgggggagattgctcccactcacctgcggggcgccctggggacgctcaaccaactggccattgttatcggcattctgatcgcccaggtgctgggcttggagtccctcctgggcactgccagcctgtggccactgctcctgggcctcacagtgctacctgccctcctgcagctggtcctgctgcccttctgtcccgagagcccccgctacctctacatcatccagaatctcgaggggcctgccagaaagagtctgaagcgcctgacaggctgggccgatgtttctggagtgctggctgagctgaaggatgagaagcggaagctggagcgtgagcggccactgtccctgctccagctcctgggcagccgtacccaccggcagcccctgatcattgcggtcgtgctgcagctgagccagcagctctctggcatcaatgctgttttctattattcgaccagcatcttcgagacagcaggggtaggccagcctgcctatgccaccataggagctggtgtggtcaacacagtcttcaccttggtctcggtgttgttggtggagcgggcggggcgccggacgctccatctcctgggcctggcgggcatgtgtggctgtgccatcctgatgactgtggctctgctcctgctggagcgagttccagccatgagctacgtctccattgtggccatctttggcttcgtggcattttttgagattggccctggccccattccttggttcatcgtggccgagctcttcagccagggaccccgcccggcagccatggctgtggctggtttctccaactggacgagcaacttcatcattggcatgggtttccagtatgttgcggaggctatggggccctacgtcttccttctatttgcggtcctcctgctgggcttcttcatcttcaccttcttaagagtacctgaaactcgaggccggacgtttgaccagatctcagctgccttccaccggacaccctctcttttagagcaggaggtgaaacccagcacagaacttgagtatttagggccagatgagaacgactga
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,760 Da
NCBI Official Full Name
Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 4, mRNA
NCBI Official Synonym Full Names
solute carrier family 2 member 4
NCBI Official Symbol
SLC2A4
NCBI Official Synonym Symbols
GLUT4
NCBI Protein Information
solute carrier family 2, facilitated glucose transporter member 4
UniProt Protein Name
Solute carrier family 2, facilitated glucose transporter member 4
Protein Family
UniProt Gene Name
SLC2A4
UniProt Synonym Gene Names
GLUT4; GLUT-4
UniProt Entry Name
GTR4_HUMAN

NCBI Description

This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]

Uniprot Description

GLUT4: an integral membrane facilitative glucose transporter. One of 13 members of the human equilibrative glucose transport protein family. Its surface expression is regulated by insulin. Has two internalization sequences, a dileucine repeat present in the C-terminus and a FxxY motif in the amino-terminal end. Associates with an intracellular tubulo-vesicular compartment under low plasma conditions. The binding of insulin to the insulin receptor (a typosine kinase) leads to the rapid translocation of GLUT4 to the cell surface, increasing cellular glucose transport activity. Its translocation to the plasma membrane is also stimulated by exercise, but independent from insulin signaling. This insulin-independent pathway may be regulated by AMPK.

Protein type: Membrane protein, multi-pass; Transporter, SLC family; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 17p13

Cellular Component: clathrin-coated vesicle; endomembrane system; external side of plasma membrane; membrane; perinuclear region of cytoplasm; plasma membrane; vesicle membrane

Molecular Function: D-glucose transmembrane transporter activity; glucose transmembrane transporter activity; protein binding

Biological Process: carbohydrate metabolic process; cellular response to insulin stimulus; glucose homeostasis; glucose transport

Disease: Diabetes Mellitus, Noninsulin-dependent

Research Articles on SLC2A4

Similar Products

Product Notes

The SLC2A4 slc2a4 (Catalog #AAA1276591) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtcgg gcttccaaca gataggctcc gaagatgggg aaccccctca gcagcgagtg actgggaccc tggtccttgc tgtgttctct gcggtgcttg gctccctgca gtttgggtac aacattgggg tcatcaatgc ccctcagaag gtgattgaac agagctacaa tgagacgtgg ctggggaggc aggggcctga gggacccagc tccatccctc caggcaccct caccaccctc tgggccctct ccgtggccat cttttccgtg ggcggcatga tttcctcctt cctcattggt atcatctctc agtggcttgg aaggaaaagg gccatgctgg tcaacaatgt cctggcggtg ctggggggca gcctcatggg cctggccaac gctgctgcct cctatgaaat gctcatcctt ggacgattcc tcattggcgc ctactcaggg ctgacatcag ggctggtgcc catgtacgtg ggggagattg ctcccactca cctgcggggc gccctgggga cgctcaacca actggccatt gttatcggca ttctgatcgc ccaggtgctg ggcttggagt ccctcctggg cactgccagc ctgtggccac tgctcctggg cctcacagtg ctacctgccc tcctgcagct ggtcctgctg cccttctgtc ccgagagccc ccgctacctc tacatcatcc agaatctcga ggggcctgcc agaaagagtc tgaagcgcct gacaggctgg gccgatgttt ctggagtgct ggctgagctg aaggatgaga agcggaagct ggagcgtgag cggccactgt ccctgctcca gctcctgggc agccgtaccc accggcagcc cctgatcatt gcggtcgtgc tgcagctgag ccagcagctc tctggcatca atgctgtttt ctattattcg accagcatct tcgagacagc aggggtaggc cagcctgcct atgccaccat aggagctggt gtggtcaaca cagtcttcac cttggtctcg gtgttgttgg tggagcgggc ggggcgccgg acgctccatc tcctgggcct ggcgggcatg tgtggctgtg ccatcctgat gactgtggct ctgctcctgc tggagcgagt tccagccatg agctacgtct ccattgtggc catctttggc ttcgtggcat tttttgagat tggccctggc cccattcctt ggttcatcgt ggccgagctc ttcagccagg gaccccgccc ggcagccatg gctgtggctg gtttctccaa ctggacgagc aacttcatca ttggcatggg tttccagtat gttgcggagg ctatggggcc ctacgtcttc cttctatttg cggtcctcct gctgggcttc ttcatcttca ccttcttaag agtacctgaa actcgaggcc ggacgtttga ccagatctca gctgccttcc accggacacc ctctctttta gagcaggagg tgaaacccag cacagaactt gagtatttag ggccagatga gaacgactga. It is sometimes possible for the material contained within the vial of "SLC2A4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.