SLC2A13 cdna clone
SLC2A13 cDNA Clone
Gene Names
SLC2A13; HMIT
Synonyms
SLC2A13; SLC2A13 cDNA Clone; SLC2A13 cdna clone
Sequence
atgggcgagcggcgcaggaagcagccggagccggacgcggcgagcgcggccggggagtgcagcctcctggctgccgccgaatcgagcaccagcctgcagagcgcgggcgcgggcggcggcggcgtcggggacctggagcgcgcggcgcggcggcagttccagcaggacgagacccccgccttcgtgtacgtggtggccgtcttctccgcgctgggcggcttcctgtttggctatgacaccggggtggtgtcaggggccatgctgctgctcaagcggcagctcagtctggacgcgctgtggcaggagctgctggtgtccagcacggtgggggcggctgccgtctcggcgctggccggaggcgccctcaacggcgtcttcggccgccgcgctgccatcctcctggccagtgccctcttcaccgccggctccgcggtgctggctgcggccaacaacaaggagacactgctcgccggccgcctggtcgtgggactcggcatcggcattgcttctatgacagtgccagtgtacattgcggaggtctcaccacccaatttaagaggccgattagtcaccattaataccctcttcatcacaggagggcagttctttgcaagtgttgttgatggagccttcagttatctccagaaggatggatggaggtacatgttgggacttgcagcagttccggcggttatacagttttttggctttctctttttgcctgaaagccctcgatggcttattcagaaaggacagactcagaaggcccgtagaattttatctcagatgcgtggtaaccagaccattgatgaggaatatgatagcatcaaaaacaacattgaagaggaggaaaaagaggttggctcagctggacctgtgatctgcagaatgctgagttatcccccaactcgccgagctttaattgtgggttgtggcctacaaatgttccagcagctctcaggcattaacaccatcatgtactacagtgcaaccattctgcagatgtctggtgttgaagatgatagacttgcaatatggctggcttcagttacagccttcacaaatttcattttcacacttgtgggagtctggcttgttgagaaggtgggccgcagaaagcttacctttggtagtttagcaggtaccaccgtagcactcattattcttgccttgggatttgtgctatcagcccaagtttccccacgcatcacttttaagccaatagctccgtcaggtcagaacgccacttgcacaagatacagttactgtaatgaatgtatgttggatccagactgcggtttctgctacaagatgaacaaatcaactgtcattgactcctcctgtgttccagttaataaagcatctacaaatgaggcagcctggggcaggtgtgaaaatgaaaccaagttcaaaacagaagatatattttgggcttacaatttctgccctactccatactcctggactgcacttctgggccttattttatatcttgtcttctttgcacctggaatgggaccaatgccttggactgtgaattctgaaatatatcccctttgggcaagaagtacaggaaatgcatgttcatctggaataaactggattttcaatgtcctggtttcactaacatttttacacacagcagagtatcttacatactatggagctttcttcctctatgctggatttgctgctgtgggactccttttcatctatggctgtcttcctgagaccaaaggcaaaaaattagaggaaattgaatcactctttgacaacaggctatgtacatgtggcacttcagattctgatgaagggagatatattgaatatattcgggtaaagggaagtaactatcatctttctgacaatgatgcttctgatgtggaataa
Sequence Length
1890
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
70,371 Da
NCBI Official Full Name
Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 13, mRNA
NCBI Official Synonym Full Names
solute carrier family 2 member 13
NCBI Official Symbol
SLC2A13
NCBI Official Synonym Symbols
HMIT
NCBI Protein Information
proton myo-inositol cotransporter
UniProt Protein Name
Proton myo-inositol cotransporter
Protein Family
UniProt Gene Name
SLC2A13
UniProt Synonym Gene Names
H(+)-myo-inositol cotransporter; Hmit
UniProt Entry Name
MYCT_HUMAN
Uniprot Description
GLUT13: an integral membrane facilitative glucose transporter. One of 13 members of the human equilibrative glucose transport protein family. Its mRNA is expressed mainly in the brain, especially the hippocampus, hypothalamus, cerebellum and brainstem. Expressed in both neurons and glial cells. It may play a key role in the control of myo-inositol metabolism in the brain. Low levels have been observed in white, brown and epididymal adipose tissues and in the kidney.
Protein type: Membrane protein, integral; Transporter; Transporter, SLC family; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 12q12
Cellular Component: integral to plasma membrane; plasma membrane
Molecular Function: glucose transmembrane transporter activity; myo-inositol:hydrogen symporter activity; sugar:hydrogen ion symporter activity
Biological Process: glucose import
Research Articles on SLC2A13
Similar Products
Product Notes
The SLC2A13 slc2a13 (Catalog #AAA1278105) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcgagc ggcgcaggaa gcagccggag ccggacgcgg cgagcgcggc cggggagtgc agcctcctgg ctgccgccga atcgagcacc agcctgcaga gcgcgggcgc gggcggcggc ggcgtcgggg acctggagcg cgcggcgcgg cggcagttcc agcaggacga gacccccgcc ttcgtgtacg tggtggccgt cttctccgcg ctgggcggct tcctgtttgg ctatgacacc ggggtggtgt caggggccat gctgctgctc aagcggcagc tcagtctgga cgcgctgtgg caggagctgc tggtgtccag cacggtgggg gcggctgccg tctcggcgct ggccggaggc gccctcaacg gcgtcttcgg ccgccgcgct gccatcctcc tggccagtgc cctcttcacc gccggctccg cggtgctggc tgcggccaac aacaaggaga cactgctcgc cggccgcctg gtcgtgggac tcggcatcgg cattgcttct atgacagtgc cagtgtacat tgcggaggtc tcaccaccca atttaagagg ccgattagtc accattaata ccctcttcat cacaggaggg cagttctttg caagtgttgt tgatggagcc ttcagttatc tccagaagga tggatggagg tacatgttgg gacttgcagc agttccggcg gttatacagt tttttggctt tctctttttg cctgaaagcc ctcgatggct tattcagaaa ggacagactc agaaggcccg tagaatttta tctcagatgc gtggtaacca gaccattgat gaggaatatg atagcatcaa aaacaacatt gaagaggagg aaaaagaggt tggctcagct ggacctgtga tctgcagaat gctgagttat cccccaactc gccgagcttt aattgtgggt tgtggcctac aaatgttcca gcagctctca ggcattaaca ccatcatgta ctacagtgca accattctgc agatgtctgg tgttgaagat gatagacttg caatatggct ggcttcagtt acagccttca caaatttcat tttcacactt gtgggagtct ggcttgttga gaaggtgggc cgcagaaagc ttacctttgg tagtttagca ggtaccaccg tagcactcat tattcttgcc ttgggatttg tgctatcagc ccaagtttcc ccacgcatca cttttaagcc aatagctccg tcaggtcaga acgccacttg cacaagatac agttactgta atgaatgtat gttggatcca gactgcggtt tctgctacaa gatgaacaaa tcaactgtca ttgactcctc ctgtgttcca gttaataaag catctacaaa tgaggcagcc tggggcaggt gtgaaaatga aaccaagttc aaaacagaag atatattttg ggcttacaat ttctgcccta ctccatactc ctggactgca cttctgggcc ttattttata tcttgtcttc tttgcacctg gaatgggacc aatgccttgg actgtgaatt ctgaaatata tcccctttgg gcaagaagta caggaaatgc atgttcatct ggaataaact ggattttcaa tgtcctggtt tcactaacat ttttacacac agcagagtat cttacatact atggagcttt cttcctctat gctggatttg ctgctgtggg actccttttc atctatggct gtcttcctga gaccaaaggc aaaaaattag aggaaattga atcactcttt gacaacaggc tatgtacatg tggcacttca gattctgatg aagggagata tattgaatat attcgggtaa agggaagtaa ctatcatctt tctgacaatg atgcttctga tgtggaataa. It is sometimes possible for the material contained within the vial of "SLC2A13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
