Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC27A4 cdna clone

SLC27A4 cDNA Clone

Gene Names
SLC27A4; IPS; FATP4; ACSVL4
Synonyms
SLC27A4; SLC27A4 cDNA Clone; SLC27A4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccctcacgctgtctacgctgctgcaaccgggccgcatctggacggggcgccgcgcggcggagccgacgccgggccacaatgctgcttggagcctctctggtgggggtgctgctgttctccaagctggtgctgaaactgccctggacccaggtgggattctccctgttgttcctctacttgggatctggcggctggcgcttcatccgggtcttcatcaagaccatcaggcctaccttactggtgatgtgctggtgatggacgagctgggctacctgtacttccgagaccgcactggggacacgttccgctggaaaggtgagaacgtgtccaccaccgaggtggaaggcacactcagccgcctgctggacatggctgacgtggccgtgtatggtgtcgaggtgccaggaaccgagggccgggccggaatggctgctgtggccagccccactggcaactgtgacctggagcgctttgctcaggtcttggagaaggaactgcccctgtatgcgcgccccatcttcctgcgcctcctgcctgagctgcacaaaacaggaacctacaagttccagaagacagagctacggaaggagggctttgacccggctattgtgaaagacccgctgttctatctagatgcccagaagggccgctacgtcccgctggaccaagaggcctacagccgcatccaggcaggcgaggagaagctgtga
Sequence Length
714
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,001 Da
NCBI Official Full Name
Homo sapiens solute carrier family 27 (fatty acid transporter), member 4, mRNA
NCBI Official Synonym Full Names
solute carrier family 27 member 4
NCBI Official Symbol
SLC27A4
NCBI Official Synonym Symbols
IPS; FATP4; ACSVL4
NCBI Protein Information
long-chain fatty acid transport protein 4
UniProt Protein Name
Long-chain fatty acid transport protein 4
UniProt Gene Name
SLC27A4
UniProt Synonym Gene Names
ACSVL4; FATP4; FATP-4; Fatty acid transport protein 4
UniProt Entry Name
S27A4_HUMAN

NCBI Description

This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]

Uniprot Description

SLC27A4: Involved in translocation of long-chain fatty acids (LFCA) across the plasma membrane. Appears to be the principal fatty acid transporter in small intestinal enterocytes. Plays a role in the formation of the epidermal barrier. Required for fat absorption in early embryogenesis. Has acyl-CoA ligase activity for long-chain and very-long-chain fatty acids. Defects in SLC27A4 are the cause of ichthyosis prematurity syndrome (IPS). A keratinization disorder characterized by complications in the second trimester of pregnancy resulting from polyhydramnion, with premature birth of a child with thick caseous desquamating epidermis, respiratory complications and transient eosinophilia. After recovery during the first months of life, the symptoms are relatively benign and the patients suffer from a lifelong non-scaly ichthyosis with atopic manifestations. Belongs to the ATP-dependent AMP-binding enzyme family.

Protein type: Transporter, SLC family; Membrane protein, multi-pass; EC 6.2.1.-; Membrane protein, integral; Ligase; Transporter

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: endoplasmic reticulum membrane; membrane; plasma membrane

Molecular Function: fatty acid transporter activity; long-chain-fatty-acid-CoA ligase activity

Biological Process: fatty acid transport; lipid metabolic process; long-chain fatty acid metabolic process; long-chain fatty acid transport; transport

Disease: Ichthyosis Prematurity Syndrome

Research Articles on SLC27A4

Similar Products

Product Notes

The SLC27A4 slc27a4 (Catalog #AAA1272305) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccctca cgctgtctac gctgctgcaa ccgggccgca tctggacggg gcgccgcgcg gcggagccga cgccgggcca caatgctgct tggagcctct ctggtggggg tgctgctgtt ctccaagctg gtgctgaaac tgccctggac ccaggtggga ttctccctgt tgttcctcta cttgggatct ggcggctggc gcttcatccg ggtcttcatc aagaccatca ggcctacctt actggtgatg tgctggtgat ggacgagctg ggctacctgt acttccgaga ccgcactggg gacacgttcc gctggaaagg tgagaacgtg tccaccaccg aggtggaagg cacactcagc cgcctgctgg acatggctga cgtggccgtg tatggtgtcg aggtgccagg aaccgagggc cgggccggaa tggctgctgt ggccagcccc actggcaact gtgacctgga gcgctttgct caggtcttgg agaaggaact gcccctgtat gcgcgcccca tcttcctgcg cctcctgcct gagctgcaca aaacaggaac ctacaagttc cagaagacag agctacggaa ggagggcttt gacccggcta ttgtgaaaga cccgctgttc tatctagatg cccagaaggg ccgctacgtc ccgctggacc aagaggccta cagccgcatc caggcaggcg aggagaagct gtga. It is sometimes possible for the material contained within the vial of "SLC27A4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.