Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC27A2 cdna clone

SLC27A2 cDNA Clone

Gene Names
SLC27A2; VLCS; FATP2; VLACS; ACSVL1; FACVL1; hFACVL1; HsT17226
Synonyms
SLC27A2; SLC27A2 cDNA Clone; SLC27A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctttccgccatctacacagtcctggcgggactgctgttcctgccgctcctggtgaacctctgctgcccatacttcttccaggacataggctacttcttgaaggtggccgccgtgggccggagggtgcgcagctacgggaagcggcggccggcgcgcaccatcctgcgggcgttcctggagaaagcgcgccagacgccacacaagccttttctgctcttccgcgacgagactctcacctacgcgcaggtggaccggcgcagcaatcaagtggcccgggcgctgcacgaccacctcggcctgcgccagggagactgcgtggcgctccttatgggtaacgagccggcctacgtgtggctgtggctggggctggtgaagctgggctgtgccatggcgtgcctcaattacaacatccgcgcgaagtccctgctgcactgcttccagtgctgcggggcgaaggtgctgctggtgtcgccagaactacaagcagctgtcgaagagatactgccaagccttaaaaaagatgatgtgtccatctattatgtgagcagaacttctaacacagatgggattgactctttcctggacaaagtggatgaagtatcaactgaacctatcccagagtcatggaggtctgaagtcactttttccactcctgccttatacatttatacttctggaaccacaggtgctactcttgccttgcggactaaattttcagccagccagttttgggatgactgcagaaaatacaacgtcactgtcattcagtatatcggtgaactgcttcggtatttatgcaactcaccacagaaaccaaatgaccgtgatcataaagtgagactggcactgggaaatggcttacgaggagatgtgtggagacaatttgtcaagagatttggggacatatgcatctatgagttctatgctgccactgaaggcaatattggatttatgaattatgcgagaaaagttggtgctgttggaagagtaaactacctacagaaaaaaatcataacttatgacctgattaaatatgatgtggagaaagatgaacctgtccgtgatgaaaatggatattgcgtcagagttcccaaaggtgaagttggacttctggtttgcaaaatcacacaacttacaccatttaatggctatgctggagcaaaggctcagacagagaagaaaaaactgagagatgtctttaagaaaggagacctctatttcaacagtggagatctcttaatggttgaccatgaaaatttcatctatttccacgacagagttggagatacattccggtggaaaggggaaaatgtggccaccactgaagttgctgatacagttggactggttgattttgtccaagaagtaaatgtttatggagtgcatgtgccagatcatgagggtcgcattggcatggcctccatcaaaatgaaagaaaaccatgaatttgatggaaagaaactctttcagcacattgctgattacctacctagttatgcaaggccccggtttctaagaatacaggacaccattgagatcactggaacttttaaacaccgcaaaatgaccctggtggaggagggctttaaccctgctgtcatcaaagatgccttgtatttcttggatgacacagcaaaaatgtatgtgcctatgactgaggacatctataatgccataagtgctaaaaccctgaaactctga
Sequence Length
1704
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,616 Da
NCBI Official Full Name
Homo sapiens solute carrier family 27 (fatty acid transporter), member 2, mRNA
NCBI Official Synonym Full Names
solute carrier family 27 member 2
NCBI Official Symbol
SLC27A2
NCBI Official Synonym Symbols
VLCS; FATP2; VLACS; ACSVL1; FACVL1; hFACVL1; HsT17226
NCBI Protein Information
very long-chain acyl-CoA synthetase
UniProt Protein Name
Very long-chain acyl-CoA synthetase
UniProt Gene Name
SLC27A2
UniProt Synonym Gene Names
ACSVL1; FACVL1; FATP2; VLACS; VLACS; VLCS; FATP-2
UniProt Entry Name
S27A2_HUMAN

NCBI Description

The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]

Uniprot Description

SLC27A2: Acyl-CoA synthetase probably involved in bile acid metabolism. Proposed to activate C27 precurors of bile acids to their CoA thioesters derivatives before side chain cleavage via peroxisomal beta-oxidation occurs. In vitro, activates 3-alpha,7- alpha,12-alpha-trihydroxy-5-beta-cholestanate (THCA), the C27 precursor of cholic acid deriving from the de novo synthesis from cholesterol. Does not utilize C24 bile acids as substrates. In vitro, also activates long- and branched-chain fatty acids and may have additional roles in fatty acid metabolism. May be involved in translocation of long-chain fatty acids (LFCA) across membranes. Belongs to the ATP-dependent AMP-binding enzyme family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Membrane protein, integral; EC 6.2.1.3; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 15q21.2

Cellular Component: endoplasmic reticulum lumen; endoplasmic reticulum membrane; integral to endoplasmic reticulum membrane; integral to peroxisomal membrane; peroxisomal membrane

Molecular Function: enzyme binding; long-chain-fatty-acid-CoA ligase activity; phytanate-CoA ligase activity; receptor binding; very-long-chain-fatty-acid-CoA ligase activity

Biological Process: bile acid biosynthetic process; fatty acid alpha-oxidation; fatty acid beta-oxidation; long-chain fatty acid metabolic process

Research Articles on SLC27A2

Similar Products

Product Notes

The SLC27A2 slc27a2 (Catalog #AAA1276300) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctttccg ccatctacac agtcctggcg ggactgctgt tcctgccgct cctggtgaac ctctgctgcc catacttctt ccaggacata ggctacttct tgaaggtggc cgccgtgggc cggagggtgc gcagctacgg gaagcggcgg ccggcgcgca ccatcctgcg ggcgttcctg gagaaagcgc gccagacgcc acacaagcct tttctgctct tccgcgacga gactctcacc tacgcgcagg tggaccggcg cagcaatcaa gtggcccggg cgctgcacga ccacctcggc ctgcgccagg gagactgcgt ggcgctcctt atgggtaacg agccggccta cgtgtggctg tggctggggc tggtgaagct gggctgtgcc atggcgtgcc tcaattacaa catccgcgcg aagtccctgc tgcactgctt ccagtgctgc ggggcgaagg tgctgctggt gtcgccagaa ctacaagcag ctgtcgaaga gatactgcca agccttaaaa aagatgatgt gtccatctat tatgtgagca gaacttctaa cacagatggg attgactctt tcctggacaa agtggatgaa gtatcaactg aacctatccc agagtcatgg aggtctgaag tcactttttc cactcctgcc ttatacattt atacttctgg aaccacaggt gctactcttg ccttgcggac taaattttca gccagccagt tttgggatga ctgcagaaaa tacaacgtca ctgtcattca gtatatcggt gaactgcttc ggtatttatg caactcacca cagaaaccaa atgaccgtga tcataaagtg agactggcac tgggaaatgg cttacgagga gatgtgtgga gacaatttgt caagagattt ggggacatat gcatctatga gttctatgct gccactgaag gcaatattgg atttatgaat tatgcgagaa aagttggtgc tgttggaaga gtaaactacc tacagaaaaa aatcataact tatgacctga ttaaatatga tgtggagaaa gatgaacctg tccgtgatga aaatggatat tgcgtcagag ttcccaaagg tgaagttgga cttctggttt gcaaaatcac acaacttaca ccatttaatg gctatgctgg agcaaaggct cagacagaga agaaaaaact gagagatgtc tttaagaaag gagacctcta tttcaacagt ggagatctct taatggttga ccatgaaaat ttcatctatt tccacgacag agttggagat acattccggt ggaaagggga aaatgtggcc accactgaag ttgctgatac agttggactg gttgattttg tccaagaagt aaatgtttat ggagtgcatg tgccagatca tgagggtcgc attggcatgg cctccatcaa aatgaaagaa aaccatgaat ttgatggaaa gaaactcttt cagcacattg ctgattacct acctagttat gcaaggcccc ggtttctaag aatacaggac accattgaga tcactggaac ttttaaacac cgcaaaatga ccctggtgga ggagggcttt aaccctgctg tcatcaaaga tgccttgtat ttcttggatg acacagcaaa aatgtatgtg cctatgactg aggacatcta taatgccata agtgctaaaa ccctgaaact ctga. It is sometimes possible for the material contained within the vial of "SLC27A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.