Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC25A6 cdna clone

SLC25A6 cDNA Clone

Gene Names
SLC25A6; ANT; AAC3; ANT3; ANT 2; ANT 3; ANT3Y
Synonyms
SLC25A6; SLC25A6 cDNA Clone; SLC25A6 cdna clone
Ordering
For Research Use Only!
Sequence
atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgtccgcatccccaaggagcagggcgtgctgtccttctggaggggcaaccttgccaacgtcattcgctacttccccactcaagccctcaacttcgccttcaaggataagtacaagcagatcttcctggggggcgtggacaagcacacgcagttctggaggtactttgcgggcaacctggcctccggcggtgcggccggcgcgacctccctctgcttcgtgtacccgctggattttgccagaacccgcctggcagcggacgtgggaaagtcaggcacagagcgcgagttccgaggcctgggagactgcctggtgaagatcaccaagtccgacggcatccggggcctgtaccagggcttcagtgtctccgtgcagggcatcatcatctaccgggcggcctacttcggcgtgtacgatacggccaagggcatgctccccgaccccaagaacacgcacatcgtggtgagctggatgatcgcgcagaccgtgacggccgtggccggcgtggtgtcctaccccttcgacacggtgcggcggcgcatgatgatgcagttcgggcgcaaaggagctgacatcatgtacacgggcaccgtcgactgttggaggaagatcttcagagatgaggggggcaaggccttcttcaagggtgcgtggtccaacgtcctgcggggcatggggggcgccttcgtgctggtcctgtacgacgagctcaagaaggtgatctaa
Sequence Length
897
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
293
Molecular Weight
32,866 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 6
NCBI Official Symbol
SLC25A6
NCBI Official Synonym Symbols
ANT; AAC3; ANT3; ANT 2; ANT 3; ANT3Y
NCBI Protein Information
ADP/ATP translocase 3
UniProt Protein Name
ADP/ATP translocase 3
Protein Family
UniProt Gene Name
SLC25A6
UniProt Synonym Gene Names
ANT3; ANT 2; ANT 3
UniProt Entry Name
ADT3_HUMAN

NCBI Description

This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Jun 2013]

Uniprot Description

SLC25A6: Catalyzes the exchange of cytoplasmic ADP with mitochondrial ATP across the mitochondrial inner membrane. May participate in the formation of the permeability transition pore complex (PTPC) responsible for the release of mitochondrial products that triggers apoptosis. Belongs to the mitochondrial carrier family.

Protein type: Transporter, SLC family; Membrane protein, integral; Membrane protein, multi-pass; Transporter; Mitochondrial

Chromosomal Location of Human Ortholog: Xp22.32 and Yp11.3

Cellular Component: extracellular matrix; mitochondrial inner membrane; mitochondrial inner membrane presequence translocase complex; mitochondrion; nucleus

Molecular Function: adenine transmembrane transporter activity; protein binding; structural constituent of ribosome

Biological Process: active induction of host immune response by virus; protein targeting to mitochondrion; regulation of insulin secretion; translation

Research Articles on SLC25A6

Similar Products

Product Notes

The SLC25A6 slc25a6 (Catalog #AAA1274312) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggaac aggccatctc cttcgccaaa gacttcttgg ccggaggcat cgccgccgcc atctccaaga cggccgtggc tccgatcgag cgggtcaagc tgctgctgca ggtccagcac gccagcaagc agatcgccgc cgacaagcag tacaagggca tcgtggactg cattgtccgc atccccaagg agcagggcgt gctgtccttc tggaggggca accttgccaa cgtcattcgc tacttcccca ctcaagccct caacttcgcc ttcaaggata agtacaagca gatcttcctg gggggcgtgg acaagcacac gcagttctgg aggtactttg cgggcaacct ggcctccggc ggtgcggccg gcgcgacctc cctctgcttc gtgtacccgc tggattttgc cagaacccgc ctggcagcgg acgtgggaaa gtcaggcaca gagcgcgagt tccgaggcct gggagactgc ctggtgaaga tcaccaagtc cgacggcatc cggggcctgt accagggctt cagtgtctcc gtgcagggca tcatcatcta ccgggcggcc tacttcggcg tgtacgatac ggccaagggc atgctccccg accccaagaa cacgcacatc gtggtgagct ggatgatcgc gcagaccgtg acggccgtgg ccggcgtggt gtcctacccc ttcgacacgg tgcggcggcg catgatgatg cagttcgggc gcaaaggagc tgacatcatg tacacgggca ccgtcgactg ttggaggaag atcttcagag atgagggggg caaggccttc ttcaagggtg cgtggtccaa cgtcctgcgg ggcatggggg gcgccttcgt gctggtcctg tacgacgagc tcaagaaggt gatctaa. It is sometimes possible for the material contained within the vial of "SLC25A6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.