SLC25A16 cdna clone
SLC25A16 cDNA Clone
Gene Names
SLC25A16; GDA; GDC; ML7; hML7; HGT.1; D10S105E
Synonyms
SLC25A16; SLC25A16 cDNA Clone; SLC25A16 cdna clone
Sequence
atggcggcggcgacggccgcggcagccctggcggcggccgatccccctcccgcaatgccgcaggcggcaggggccggagggcccacaacccgcagagacttctactggctgcgctcctttctggccggaggtattgctggatgctgtgccaaaacaacagttgctccattggatcgagtaaaggttttattacaagctcacaatcaccattacaagcatttaggagtattttctgcattgcgtgctgttcctcaaaaagaaggattccttggattgtataaaggaaatggtgcaatgatgattcgaatctttccctatggtgcaatccagtttatggcatttgagcattataaaacgttaattactacgaagctgggaatttcaggtcatgtgcacagattaatggctggatccatggcaggtatgacagcagttatctgtacttaccctcttgacatggttagggtccgcctagcattccaggtgaaaggggaacacagctatacaggaattattcatgctttcaaaacaatttatgcaaaggaaggtggtttctttggattttacagaggtctgatgcctactattttaggaatggctccatatgcaggtgtttcattttttacttttggtaccttgaagagtgttgggctttcccatgctcctacccttcttggcagaccttcatcagacaatcctaatgtcttagttttgaaaactcatgtaaacttactttgtggtggtgttgctggagcaatagcgcagacaatatcctacccatttgatgtgactcgtcggcgaatgcaattaggaactgttctgccggaatttgaaaagtgccttaccatgcgggatactatgaagtatgtctatggacaccatggaattcgaaaaggactctatcgtggtttatctcttaattacattcgctgtattccctctcaagcagtggcttttacaacatacgaacttatgaagcagttttttcacctcaactaa
Sequence Length
999
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,224 Da
NCBI Official Full Name
Homo sapiens solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16, mRNA
NCBI Official Synonym Full Names
solute carrier family 25 member 16
NCBI Official Symbol
SLC25A16
NCBI Official Synonym Symbols
GDA; GDC; ML7; hML7; HGT.1; D10S105E
NCBI Protein Information
graves disease carrier protein
UniProt Protein Name
Graves disease carrier protein
Protein Family
UniProt Gene Name
SLC25A16
UniProt Synonym Gene Names
GDA; GDC; GDA
UniProt Entry Name
GDC_HUMAN
NCBI Description
This gene encodes a protein that contains three tandemly repeated mitochondrial carrier protein domains. The encoded protein is localized in the inner membrane and facilitates the rapid transport and exchange of molecules between the cytosol and the mitochondrial matrix space. This gene has a possible role in Graves' disease. [provided by RefSeq, Jul 2008]
Uniprot Description
SLC25A16: Required for the accumulation of coenzyme A in the mitochondrial matrix. Belongs to the mitochondrial carrier family.
Protein type: Membrane protein, integral; Mitochondrial; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 10q21.3
Cellular Component: mitochondrial inner membrane
Molecular Function: secondary active transmembrane transporter activity; structural constituent of ribosome
Biological Process: coenzyme biosynthetic process; translation
Research Articles on SLC25A16
Similar Products
Product Notes
The SLC25A16 slc25a16 (Catalog #AAA1269667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cgacggccgc ggcagccctg gcggcggccg atccccctcc cgcaatgccg caggcggcag gggccggagg gcccacaacc cgcagagact tctactggct gcgctccttt ctggccggag gtattgctgg atgctgtgcc aaaacaacag ttgctccatt ggatcgagta aaggttttat tacaagctca caatcaccat tacaagcatt taggagtatt ttctgcattg cgtgctgttc ctcaaaaaga aggattcctt ggattgtata aaggaaatgg tgcaatgatg attcgaatct ttccctatgg tgcaatccag tttatggcat ttgagcatta taaaacgtta attactacga agctgggaat ttcaggtcat gtgcacagat taatggctgg atccatggca ggtatgacag cagttatctg tacttaccct cttgacatgg ttagggtccg cctagcattc caggtgaaag gggaacacag ctatacagga attattcatg ctttcaaaac aatttatgca aaggaaggtg gtttctttgg attttacaga ggtctgatgc ctactatttt aggaatggct ccatatgcag gtgtttcatt ttttactttt ggtaccttga agagtgttgg gctttcccat gctcctaccc ttcttggcag accttcatca gacaatccta atgtcttagt tttgaaaact catgtaaact tactttgtgg tggtgttgct ggagcaatag cgcagacaat atcctaccca tttgatgtga ctcgtcggcg aatgcaatta ggaactgttc tgccggaatt tgaaaagtgc cttaccatgc gggatactat gaagtatgtc tatggacacc atggaattcg aaaaggactc tatcgtggtt tatctcttaa ttacattcgc tgtattccct ctcaagcagt ggcttttaca acatacgaac ttatgaagca gttttttcac ctcaactaa. It is sometimes possible for the material contained within the vial of "SLC25A16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
