SLC24A5 cdna clone
SLC24A5 cDNA Clone
Gene Names
SLC24A5; JSX; OCA6; NCKX5; SHEP4
Synonyms
SLC24A5; SLC24A5 cDNA Clone; SLC24A5 cdna clone
Sequence
atgcagacaaaagggggccaaacatgggcgagaagggctctgttgctcggcatcctgtgggccactgcacatctgcctctctcagggacctccctgccccaacgtctcccaagggccacaggaaatagcacccaatgtgttatttctccatcatcggagtttcccgaagggtttttcacgagacaggagcgcagagatggaggcatcataatctatttcctaattatcgtttacatgttcatggccatatctattgtctgtgatgaatacttcctaccctccctggaaatcatcagtgaatcccttggattgtctcaggatgttgcaggcacaactttcatggcagcgggcagttcagctcctgaattagttactgctttcctaggtgtatttatcacaaagggagatattggcattagcaccatccttggatctgcaatttataatctccttggcatctgtgctgcctgtggtttgctatctaatacggtctcaacactatcatgttggcccctattcagagactgtgcagcgtacacaattagtgcagcagcagttcttggtataatatatgacaaccaagtttactggtatgaaggggctttactgcttttgatatatggattgtatgttttggtgctgtgttttgacattaaaattaaccaatatattataaagaaatgcagtccttgctgcgcctgtcttgccaaagctatggagagaagtgaacaacagccactgatgggctgggaagatgaaggtcaaccattcattcgtcggcaatcaagaactgatagtggaatattttatgaagattctggctactctcagctctctataagtttacatggccttagtcaggtttctgaagatccaccaagtgttttcaacatgcctgaagcagacttaaaaagaattttttgggtattatcccttcctattattacattactttttctaaccacaccagattgtagaaaaaagttttggaaaaactactttgtgataacctttttcatgtctgcaatatggatatccgcatttacatatatcctggtttggatggtcacaataactggggaaacactagaaattcccgatacagtaatgggccttactttattagcagcaggaacaagcataccagacacaattgcaagtgtgttggttgcaagaaaagggaaaggagatatggctatgtctaacatcgtgggatccaatgtgtttgatatgttgtgccttggtattccatggtttattaaaactgcatttataaatggatcagctcctgcagaagtaaacagcagaggactaacttacataaccatctctctcaacatttcaattatttttctttttttagcagttcacttcaatggctggaaactagacagaaagttgggaatagtctgcctattatcatacttggggcttgctacattatcagttctatatgaacttggaattattggaaataataaaataaggggctgtggaggttga
Sequence Length
1503
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,016 Da
NCBI Official Full Name
Homo sapiens solute carrier family 24, member 5, mRNA
NCBI Official Synonym Full Names
solute carrier family 24 member 5
NCBI Official Symbol
SLC24A5
NCBI Official Synonym Symbols
JSX; OCA6; NCKX5; SHEP4
NCBI Protein Information
sodium/potassium/calcium exchanger 5
UniProt Protein Name
Sodium/potassium/calcium exchanger 5
Protein Family
UniProt Gene Name
SLC24A5
UniProt Synonym Gene Names
JSX; NCKX5
UniProt Entry Name
NCKX5_HUMAN
NCBI Description
This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
Uniprot Description
SLC24A5: Cation exchanger involved in pigmentation, possibly by participating in ion transport in melanosomes. Probably transports 1 Ca(2+) and 1 K(+) in exchange for 4 Na(+). Belongs to the sodium/potassium/calcium exchanger family. SLC24A subfamily.
Protein type: Transporter, SLC family; Membrane protein, multi-pass; Transporter; Membrane protein, integral
Chromosomal Location of Human Ortholog: 15q21.1
Cellular Component: integral to plasma membrane; trans-Golgi network; trans-Golgi network membrane
Molecular Function: calcium channel activity; calcium ion binding; calcium, potassium:sodium antiporter activity; potassium ion binding; sodium ion binding
Biological Process: cellular calcium ion homeostasis; ion transport
Disease: Skin/hair/eye Pigmentation, Variation In, 4
Research Articles on SLC24A5
Similar Products
Product Notes
The SLC24A5 slc24a5 (Catalog #AAA1276781) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagacaa aagggggcca aacatgggcg agaagggctc tgttgctcgg catcctgtgg gccactgcac atctgcctct ctcagggacc tccctgcccc aacgtctccc aagggccaca ggaaatagca cccaatgtgt tatttctcca tcatcggagt ttcccgaagg gtttttcacg agacaggagc gcagagatgg aggcatcata atctatttcc taattatcgt ttacatgttc atggccatat ctattgtctg tgatgaatac ttcctaccct ccctggaaat catcagtgaa tcccttggat tgtctcagga tgttgcaggc acaactttca tggcagcggg cagttcagct cctgaattag ttactgcttt cctaggtgta tttatcacaa agggagatat tggcattagc accatccttg gatctgcaat ttataatctc cttggcatct gtgctgcctg tggtttgcta tctaatacgg tctcaacact atcatgttgg cccctattca gagactgtgc agcgtacaca attagtgcag cagcagttct tggtataata tatgacaacc aagtttactg gtatgaaggg gctttactgc ttttgatata tggattgtat gttttggtgc tgtgttttga cattaaaatt aaccaatata ttataaagaa atgcagtcct tgctgcgcct gtcttgccaa agctatggag agaagtgaac aacagccact gatgggctgg gaagatgaag gtcaaccatt cattcgtcgg caatcaagaa ctgatagtgg aatattttat gaagattctg gctactctca gctctctata agtttacatg gccttagtca ggtttctgaa gatccaccaa gtgttttcaa catgcctgaa gcagacttaa aaagaatttt ttgggtatta tcccttccta ttattacatt actttttcta accacaccag attgtagaaa aaagttttgg aaaaactact ttgtgataac ctttttcatg tctgcaatat ggatatccgc atttacatat atcctggttt ggatggtcac aataactggg gaaacactag aaattcccga tacagtaatg ggccttactt tattagcagc aggaacaagc ataccagaca caattgcaag tgtgttggtt gcaagaaaag ggaaaggaga tatggctatg tctaacatcg tgggatccaa tgtgtttgat atgttgtgcc ttggtattcc atggtttatt aaaactgcat ttataaatgg atcagctcct gcagaagtaa acagcagagg actaacttac ataaccatct ctctcaacat ttcaattatt tttctttttt tagcagttca cttcaatggc tggaaactag acagaaagtt gggaatagtc tgcctattat catacttggg gcttgctaca ttatcagttc tatatgaact tggaattatt ggaaataata aaataagggg ctgtggaggt tga. It is sometimes possible for the material contained within the vial of "SLC24A5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
