Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A2 cdna clone

SLC22A2 cDNA Clone

Gene Names
SLC22A2; OCT2
Synonyms
SLC22A2; SLC22A2 cDNA Clone; SLC22A2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaccaccgtggacgatgtcctggagcatggaggggagtttcactttttccagaagcaaatgtttttcctcttggctctgctctcggctaccttcgcgcccatctacgtgggcatcgtcttcctgggcttcacccctgaccaccgctgccggagccccggagtggccgagctgagtctgcgctgcggctggagtcctgcagaggaactgaactacacggtgccgggcccaggacctgcgggcgaagcctccccaagacagtgtaggcgctacgaggtggactggaaccagagcaccttcgactgcgtggaccccctggccagcctggacaccaacaggagccgcctgccactgggcccctgccgggacggctgggtgtacgagacgcctggctcgtccatcgtcaccgagtttaacctggtatgtgccaactcctggatgttggacctattccagtcatcagtgaatgtaggattctttattggctctatgagtatcggctacatagcagacaggtttggccgtaagctctgcctcctaactacagtcctcataaatgctgcagctggagttctcatggccatttccccaacctatacgtggatgttaatttttcgcttaatccaaggactggtcagcaaagcaggctggttaataggctacatcctgagtaagaatgtttgtgcttgcaactgtgagaacaaagcaacctcgctgccaaaatag
Sequence Length
729
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,685 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22 (organic cation transporter), member 2, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 2
NCBI Official Symbol
SLC22A2
NCBI Official Synonym Symbols
OCT2
NCBI Protein Information
solute carrier family 22 member 2
UniProt Protein Name
Solute carrier family 22 member 2
Protein Family
UniProt Gene Name
SLC22A2
UniProt Synonym Gene Names
OCT2; hOCT2
UniProt Entry Name
S22A2_HUMAN

NCBI Description

Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]

Uniprot Description

SLC22A2: Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creatinine, amantadine, memantine, acriflavine, 4-[4-(dimethylamino)-styryl]-N-methylpyridinium ASP, amiloride, metformin, N-1-methylnicotinamide (NMN), tetraethylammonium (TEA), 1-methyl-4-phenylpyridinium (MPP), cimetidine, cisplatin and oxaliplatin. Cisplatin may develop a nephrotoxic action. Transport of creatinine is inhibited by fluoroquinolones such as DX-619 and LVFX. This transporter is a major determinant of the anticancer activity of oxaliplatin and may contribute to antitumor specificity. Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Transporter; Transporter, SLC family; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 6q25.3

Cellular Component: membrane; plasma membrane

Molecular Function: choline transmembrane transporter activity; dopamine transmembrane transporter activity; neurotransmitter transporter activity; organic cation transmembrane transporter activity; quaternary ammonium group transmembrane transporter activity

Biological Process: body fluid secretion; choline transport; dopamine transport; multidrug transport; neurotransmitter biosynthetic process; neurotransmitter secretion; organic cation transport

Research Articles on SLC22A2

Similar Products

Product Notes

The SLC22A2 slc22a2 (Catalog #AAA1278292) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccacca ccgtggacga tgtcctggag catggagggg agtttcactt tttccagaag caaatgtttt tcctcttggc tctgctctcg gctaccttcg cgcccatcta cgtgggcatc gtcttcctgg gcttcacccc tgaccaccgc tgccggagcc ccggagtggc cgagctgagt ctgcgctgcg gctggagtcc tgcagaggaa ctgaactaca cggtgccggg cccaggacct gcgggcgaag cctccccaag acagtgtagg cgctacgagg tggactggaa ccagagcacc ttcgactgcg tggaccccct ggccagcctg gacaccaaca ggagccgcct gccactgggc ccctgccggg acggctgggt gtacgagacg cctggctcgt ccatcgtcac cgagtttaac ctggtatgtg ccaactcctg gatgttggac ctattccagt catcagtgaa tgtaggattc tttattggct ctatgagtat cggctacata gcagacaggt ttggccgtaa gctctgcctc ctaactacag tcctcataaa tgctgcagct ggagttctca tggccatttc cccaacctat acgtggatgt taatttttcg cttaatccaa ggactggtca gcaaagcagg ctggttaata ggctacatcc tgagtaagaa tgtttgtgct tgcaactgtg agaacaaagc aacctcgctg ccaaaatag. It is sometimes possible for the material contained within the vial of "SLC22A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.