Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A17 cdna clone

SLC22A17 cDNA Clone

Gene Names
SLC22A17; BOCT; BOIT; 24p3R; NGALR; hBOIT; NGALR2; NGALR3
Synonyms
SLC22A17; SLC22A17 cDNA Clone; SLC22A17 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcggaccccatcttcacgctggcgcccccgctgcattgccactacggggccttcccccctaatgcctctggctgggagcagcctcccaatgccagcggcgtcagcgtcgccagcgctgccctagcagccagcgccgccagccgtgtcgccaccagtaccgacccctcgtgcagcggcttcgccccgccggacttcaaccattgcctcaaggattgggactataatggccttcctgtgctcaccaccaacgccatcggccagtgggatctggtgtgtgacctgggctggcaggtgatcctggagcagatcctcttcatcttgggctttgcctccggctacctgttcctgggttaccccgcagacagatttggccgtcgcgggattgtgctgctgaccttggggctggtgggcccctgtggagtaggaggggctgctgcaggctcctccacaggcgtcatggccctccgattcctcttgggctttctgcttgccggtgttgacctgggtgtctacctgatgcgcctggagctgtgcgacccaacccagaggcttcgggtggccctggcaggggagttggtgggggtgggagggcacttcctgttcctgggcctggcccttgtctctaaggattggcgattcctacagcgaatgatcaccgctccctgcatcctcttcctgttttatggctggcctggtttgttcctggagtccgcacggtggctgatagtgaagcggcagattgaggaggctcagtctgtgctgaggatcctggctgagcgaaaccggccccatgggcagatgctgggggaggaggcccaggaggccctgcaggacctggagaatacctgccctctccctgcaacatcctccttttcctttgcttccctcctcaactaccgcaacatctggaaaaatctgcttatcctgggcttcaccaacttcattgcccatgccattcgccactgctaccagcctgtgggaggaggagggagcccatcggacttctacctgtgctctctgctggccagcggcaccgcagccctggcctgtgtcttcctgggggtcaccgtggaccgatttggccgccggggcatccttcttctctccatgacccttaccggcattgcttccctggtcctgctgggcctgtgggattgtgagcatcctatcttccccacagtgtgggctcaacaagggaaccccaacagagatctgaacgaggctgccatcaccactttctctgtccttgggctcttctcctcccaagctgccgccatcctcagcaccctccttgctgctgaggtcatccccaccactgtccggggccgtggcctgggcctgatcatggctctaggggcgcttggaggactgagcggcccggcccagcgcctccacatgggccatggagccttcctgcagcacgtggtgctggcggcctgcgccctcctctgcattctcagcattatgctgctgccggagaccaagcgcaagctcctgcccgaggtgctccgggacggggagctgtgtcgccggccttccctgctgcggcagccaccccctacccgctgtgaccacgtcccgctgcttgccacccccaaccctgccctctga
Sequence Length
1617
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,712 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22, member 17, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 17
NCBI Official Symbol
SLC22A17
NCBI Official Synonym Symbols
BOCT; BOIT; 24p3R; NGALR; hBOIT; NGALR2; NGALR3
NCBI Protein Information
solute carrier family 22 member 17
UniProt Protein Name
Solute carrier family 22 member 17
Protein Family
UniProt Gene Name
SLC22A17
UniProt Synonym Gene Names
BOCT; BOIT; 24p3R; NgalR
UniProt Entry Name
S22AH_HUMAN

Uniprot Description

SLC22A17: Cell surface receptor for LCN2 (24p3) that plays a key role in iron homeostasis and transport. Able to bind iron-bound LCN2 (holo-24p3), followed by internalization of holo-24p3 and release of iron, thereby increasing intracellular iron concentration and leading to inhibition of apoptosis. Also binds iron-free LCN2 (apo-24p3), followed by internalization of apo-24p3 and its association with an intracellular siderophore, leading to iron chelation and iron transfer to the extracellular medium, thereby reducing intracellular iron concentration and resulting in apoptosis. Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Transporter, SLC family; Transporter

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: organic anion transmembrane transporter activity; transmembrane receptor activity; transmembrane transporter activity

Biological Process: cellular iron ion homeostasis; siderophore transport

Research Articles on SLC22A17

Similar Products

Product Notes

The SLC22A17 slc22a17 (Catalog #AAA1269136) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcgg accccatctt cacgctggcg cccccgctgc attgccacta cggggccttc ccccctaatg cctctggctg ggagcagcct cccaatgcca gcggcgtcag cgtcgccagc gctgccctag cagccagcgc cgccagccgt gtcgccacca gtaccgaccc ctcgtgcagc ggcttcgccc cgccggactt caaccattgc ctcaaggatt gggactataa tggccttcct gtgctcacca ccaacgccat cggccagtgg gatctggtgt gtgacctggg ctggcaggtg atcctggagc agatcctctt catcttgggc tttgcctccg gctacctgtt cctgggttac cccgcagaca gatttggccg tcgcgggatt gtgctgctga ccttggggct ggtgggcccc tgtggagtag gaggggctgc tgcaggctcc tccacaggcg tcatggccct ccgattcctc ttgggctttc tgcttgccgg tgttgacctg ggtgtctacc tgatgcgcct ggagctgtgc gacccaaccc agaggcttcg ggtggccctg gcaggggagt tggtgggggt gggagggcac ttcctgttcc tgggcctggc ccttgtctct aaggattggc gattcctaca gcgaatgatc accgctccct gcatcctctt cctgttttat ggctggcctg gtttgttcct ggagtccgca cggtggctga tagtgaagcg gcagattgag gaggctcagt ctgtgctgag gatcctggct gagcgaaacc ggccccatgg gcagatgctg ggggaggagg cccaggaggc cctgcaggac ctggagaata cctgccctct ccctgcaaca tcctcctttt cctttgcttc cctcctcaac taccgcaaca tctggaaaaa tctgcttatc ctgggcttca ccaacttcat tgcccatgcc attcgccact gctaccagcc tgtgggagga ggagggagcc catcggactt ctacctgtgc tctctgctgg ccagcggcac cgcagccctg gcctgtgtct tcctgggggt caccgtggac cgatttggcc gccggggcat ccttcttctc tccatgaccc ttaccggcat tgcttccctg gtcctgctgg gcctgtggga ttgtgagcat cctatcttcc ccacagtgtg ggctcaacaa gggaacccca acagagatct gaacgaggct gccatcacca ctttctctgt ccttgggctc ttctcctccc aagctgccgc catcctcagc accctccttg ctgctgaggt catccccacc actgtccggg gccgtggcct gggcctgatc atggctctag gggcgcttgg aggactgagc ggcccggccc agcgcctcca catgggccat ggagccttcc tgcagcacgt ggtgctggcg gcctgcgccc tcctctgcat tctcagcatt atgctgctgc cggagaccaa gcgcaagctc ctgcccgagg tgctccggga cggggagctg tgtcgccggc cttccctgct gcggcagcca ccccctaccc gctgtgacca cgtcccgctg cttgccaccc ccaaccctgc cctctga. It is sometimes possible for the material contained within the vial of "SLC22A17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.