Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A13 cdna clone

SLC22A13 cDNA Clone

Gene Names
SLC22A13; OAT10; OCTL1; OCTL3; ORCTL3; ORCTL-3
Synonyms
SLC22A13; SLC22A13 cDNA Clone; SLC22A13 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcagtttgtccaggtcctggctgaaataggtgactttggtcgcttccagatacagctattgatcctgctgtgtgttctcaacttcctgtctcccttctacttttttgcccatgtcttcatgatcctagatgagccccaccactgtgcagtggcttgggtgaagaaccacactttcaacctgagtgctgctgaacagctggtactgagcgtgcccctggacactgcaggtcacccagagccctgcctcatgttccggccaccccccgccaatgccagcctgcaggacatcctcagccaccgcttcaatgagacgcagccttgtgatatgggctgggaatatcctgagaacaggctcccatccctgaagaatgagttcaacctggtttgtgatcggaagcacctgaaggacaccacacagtcagtgttcatggctgggctccttgttggcaccctcatgtttgggcccctctgcgaccggattggccgcaaggccacaatcctggcgcagctgctcctcttcaccctcatcggcctggccacagcttttgtgcccagctttgagctctacatggccctgcgctttgctgtggctactgccgtcgctggacttagcttcagcaatgtcaccctactgacagaatgggtggggccctcatggaggacgcaggccgtggtcctggcccagtgcaacttctccctcgggcagatggtgcttgcgggactcgcctacggtttccgcaactggaggctccttcagatcaccggcactgcgcctggcttactgctcttcttctacttctgggctctgccagaatctgcacgttggctcctgacccgtgggaggatggacgaggcgatacaactgatccagaaggcggcctcggtcaataggcggaaactctccccggagctcatgaaccagctggtcccagagaagacaggcccctcagggaatgccctggatctgttcagacacccccagctccggaaggtgaccctgattatcttctgtgtctggtttgtggacagtctggggtactacggcctgagcctccaagtgggggacttcggcctggacgtctatctgacgcagctcatctttggagctgttgaggtgcctgcccgctgttccagcatcttcatgatgcagaggtttggccgcaagtggagccagttggggaccttggtcttgggtggcctgatgtgtatcatcatcatcttcatcccagcagatctgcccgtggtggtcaccatgctggctgtggtggggaagatggccacagctgctgcctttaccatctcctatgtgtactctgccgagtttttccccaccatcctccgacaggcatggggctggtgggcatcttctcacggatcgggggcatcctcacaccacttgtga
Sequence Length
1407
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,166 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22 (organic anion transporter), member 13, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 13
NCBI Official Symbol
SLC22A13
NCBI Official Synonym Symbols
OAT10; OCTL1; OCTL3; ORCTL3; ORCTL-3
NCBI Protein Information
solute carrier family 22 member 13
UniProt Protein Name
Solute carrier family 22 member 13
Protein Family
UniProt Gene Name
SLC22A13
UniProt Synonym Gene Names
OCTL1; ORCTL3; ORCTL-3
UniProt Entry Name
S22AD_HUMAN

NCBI Description

This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]

Uniprot Description

SLC22A13: a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]

Protein type: Transporter, SLC family; Transporter; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: apical plasma membrane; integral to plasma membrane

Molecular Function: substrate-specific transmembrane transporter activity

Biological Process: urate transport

Research Articles on SLC22A13

Similar Products

Product Notes

The SLC22A13 slc22a13 (Catalog #AAA1275179) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagt ttgtccaggt cctggctgaa ataggtgact ttggtcgctt ccagatacag ctattgatcc tgctgtgtgt tctcaacttc ctgtctccct tctacttttt tgcccatgtc ttcatgatcc tagatgagcc ccaccactgt gcagtggctt gggtgaagaa ccacactttc aacctgagtg ctgctgaaca gctggtactg agcgtgcccc tggacactgc aggtcaccca gagccctgcc tcatgttccg gccacccccc gccaatgcca gcctgcagga catcctcagc caccgcttca atgagacgca gccttgtgat atgggctggg aatatcctga gaacaggctc ccatccctga agaatgagtt caacctggtt tgtgatcgga agcacctgaa ggacaccaca cagtcagtgt tcatggctgg gctccttgtt ggcaccctca tgtttgggcc cctctgcgac cggattggcc gcaaggccac aatcctggcg cagctgctcc tcttcaccct catcggcctg gccacagctt ttgtgcccag ctttgagctc tacatggccc tgcgctttgc tgtggctact gccgtcgctg gacttagctt cagcaatgtc accctactga cagaatgggt ggggccctca tggaggacgc aggccgtggt cctggcccag tgcaacttct ccctcgggca gatggtgctt gcgggactcg cctacggttt ccgcaactgg aggctccttc agatcaccgg cactgcgcct ggcttactgc tcttcttcta cttctgggct ctgccagaat ctgcacgttg gctcctgacc cgtgggagga tggacgaggc gatacaactg atccagaagg cggcctcggt caataggcgg aaactctccc cggagctcat gaaccagctg gtcccagaga agacaggccc ctcagggaat gccctggatc tgttcagaca cccccagctc cggaaggtga ccctgattat cttctgtgtc tggtttgtgg acagtctggg gtactacggc ctgagcctcc aagtggggga cttcggcctg gacgtctatc tgacgcagct catctttgga gctgttgagg tgcctgcccg ctgttccagc atcttcatga tgcagaggtt tggccgcaag tggagccagt tggggacctt ggtcttgggt ggcctgatgt gtatcatcat catcttcatc ccagcagatc tgcccgtggt ggtcaccatg ctggctgtgg tggggaagat ggccacagct gctgccttta ccatctccta tgtgtactct gccgagtttt tccccaccat cctccgacag gcatggggct ggtgggcatc ttctcacgga tcgggggcat cctcacacca cttgtga. It is sometimes possible for the material contained within the vial of "SLC22A13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.