Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A12 cdna clone

SLC22A12 cDNA Clone

Gene Names
SLC22A12; RST; OAT4L; URAT1
Synonyms
SLC22A12; SLC22A12 cDNA Clone; SLC22A12 cdna clone
Ordering
For Research Use Only!
Sequence
atggcattttctgaactcctggacctcgtgggtggcctgggcaggttccaggttctccagacgatggctctgatggtctccatcatgtggctgtgtacccagagcatgctggagaacttctcggccgccgtgcccagccaccgctgctgggcacccctcctggacaacagcacggctcaggccagcatcctagggagcttgagtcctgaggccctcctggctatttccatcccgccgggccccaaccagaggccccatcagtgccgccgcttccgccagccacagtggcagctcttggaccccaatgccacggccaccagctggagcgaggccgacacggagccgtgtgtggatggctgggtctatgaccgcagcatcttcacctccacaatcgtggccaagtggaacctcgtgtgtgactctcacgctctgaagcccatggcccagtccatctacctggctgggattctggtgggagctgctgcgtgcggccctgcctcagacaggtttgggcgcaggctggtgctaacctggagctaccttcagatggctgtgatgggtacggcagctgccttcgcccctgccttccccgtgtactgcctgttccgcttcctgttggcctttgccgtggcaggcgtcatgatgaacacgggcactctcctgatggagtggacggcggcacgggcccgacccttggtgatgaccttgaactctctgggcttcagcttcggccatggcctgacagctgcagtggcctacggtgtgcgggactggacactgctgcagctggtggtctcggtccccttcttcctctgctttttgtactcctggtggctggcagagtcggcacgatggctcctcaccacaggcaggctggattggggcctgcaggagctgtggagggtggctgccatcaacggaaagggggcagtgcaggacaccctgacccctgaggtcttgctttcagccatgcgggaggagctgagcatgggccagcctcctgccagcctgggcaccctgctccgcatgcccggactgcgcttccggacctgtatctccacgttgtgctggttcgcctttggcttcaccttcttcggcctggccctggacctgcaggccctgggcagcaacatcttcctgctccaaatgttcattggtgtcgtggacatcccagccaagatgggcgccctgctgctgctgagccacctgggccgccgccccacgctggccgcatccctgttgctggcggggctctgcattctggccaacacgctggtgccccacgaaatgggggctctgcgctcagccttggccgtgctggggctgggcggggtgggggctgccttcacctgcatcaccatctacagcagcgagctcttccccactgtgctcaggatgacggcagtgggcttgggccagatggcagcccgtggaggagccatcctggggcctctggtccggctgctgggtgtccatggcccctggctgcccttgctggtgtatgggacggtgccagtgctgagtggcctggccgcactgcttctgcccgagacccagagcttgccgctgcccgacaccatccaagatgtgcagaaccaggcagtaaagaaggcaacacatggcacgctggggaactctgtcctaaaatccacacagttttag
Sequence Length
1662
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,094 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22 (organic anion/urate transporter), member 12, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 12
NCBI Official Symbol
SLC22A12
NCBI Official Synonym Symbols
RST; OAT4L; URAT1
NCBI Protein Information
solute carrier family 22 member 12
UniProt Protein Name
Solute carrier family 22 member 12
Protein Family
UniProt Gene Name
SLC22A12
UniProt Synonym Gene Names
OATL4; URAT1; RST
UniProt Entry Name
S22AC_HUMAN

NCBI Description

The protein encoded by this gene is a member of the organic anion transporter (OAT) family, and it acts as a urate transporter to regulate urate levels in blood. This protein is an integral membrane protein primarily found in epithelial cells of the proximal tubule of the kidney. An elevated level of serum urate, hyperuricemia, is associated with increased incidences of gout, and mutations in this gene cause renal hypouricemia type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Uniprot Description

SLC22A12: Required for efficient urate re-absorption in the kidney. Regulates blood urate levels. Mediates saturable urate uptake by facilitating the exchange of urate against organic anions. Defects in SLC22A12 are the cause of hypouricemia renal type 1 (RHUC1). A disorder characterized by impaired uric acid reabsorption at the apical membrane of proximal renal tubule cells, and high urinary urate excretion. Patients often appear asymptomatic, but may be subject to exercise-induced acute renal failure, chronic renal dysfunction and nephrolithiasis. Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Transporter, SLC family; Transporter

Chromosomal Location of Human Ortholog: 11q13.1

Cellular Component: apical plasma membrane; brush border membrane; integral to membrane; integral to plasma membrane; plasma membrane

Molecular Function: inorganic anion exchanger activity; PDZ domain binding; sodium-independent organic anion transmembrane transporter activity; urate transmembrane transporter activity

Biological Process: response to drug; sodium-independent organic anion transport; urate metabolic process; urate transport

Disease: Hypouricemia, Renal, 1

Research Articles on SLC22A12

Similar Products

Product Notes

The SLC22A12 slc22a12 (Catalog #AAA1268619) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatttt ctgaactcct ggacctcgtg ggtggcctgg gcaggttcca ggttctccag acgatggctc tgatggtctc catcatgtgg ctgtgtaccc agagcatgct ggagaacttc tcggccgccg tgcccagcca ccgctgctgg gcacccctcc tggacaacag cacggctcag gccagcatcc tagggagctt gagtcctgag gccctcctgg ctatttccat cccgccgggc cccaaccaga ggccccatca gtgccgccgc ttccgccagc cacagtggca gctcttggac cccaatgcca cggccaccag ctggagcgag gccgacacgg agccgtgtgt ggatggctgg gtctatgacc gcagcatctt cacctccaca atcgtggcca agtggaacct cgtgtgtgac tctcacgctc tgaagcccat ggcccagtcc atctacctgg ctgggattct ggtgggagct gctgcgtgcg gccctgcctc agacaggttt gggcgcaggc tggtgctaac ctggagctac cttcagatgg ctgtgatggg tacggcagct gccttcgccc ctgccttccc cgtgtactgc ctgttccgct tcctgttggc ctttgccgtg gcaggcgtca tgatgaacac gggcactctc ctgatggagt ggacggcggc acgggcccga cccttggtga tgaccttgaa ctctctgggc ttcagcttcg gccatggcct gacagctgca gtggcctacg gtgtgcggga ctggacactg ctgcagctgg tggtctcggt ccccttcttc ctctgctttt tgtactcctg gtggctggca gagtcggcac gatggctcct caccacaggc aggctggatt ggggcctgca ggagctgtgg agggtggctg ccatcaacgg aaagggggca gtgcaggaca ccctgacccc tgaggtcttg ctttcagcca tgcgggagga gctgagcatg ggccagcctc ctgccagcct gggcaccctg ctccgcatgc ccggactgcg cttccggacc tgtatctcca cgttgtgctg gttcgccttt ggcttcacct tcttcggcct ggccctggac ctgcaggccc tgggcagcaa catcttcctg ctccaaatgt tcattggtgt cgtggacatc ccagccaaga tgggcgccct gctgctgctg agccacctgg gccgccgccc cacgctggcc gcatccctgt tgctggcggg gctctgcatt ctggccaaca cgctggtgcc ccacgaaatg ggggctctgc gctcagcctt ggccgtgctg gggctgggcg gggtgggggc tgccttcacc tgcatcacca tctacagcag cgagctcttc cccactgtgc tcaggatgac ggcagtgggc ttgggccaga tggcagcccg tggaggagcc atcctggggc ctctggtccg gctgctgggt gtccatggcc cctggctgcc cttgctggtg tatgggacgg tgccagtgct gagtggcctg gccgcactgc ttctgcccga gacccagagc ttgccgctgc ccgacaccat ccaagatgtg cagaaccagg cagtaaagaa ggcaacacat ggcacgctgg ggaactctgt cctaaaatcc acacagtttt ag. It is sometimes possible for the material contained within the vial of "SLC22A12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.