SLC10A3 cdna clone
SLC10A3 cDNA Clone
Gene Names
SLC10A3; P3; DXS253E
Synonyms
SLC10A3; SLC10A3 cDNA Clone; SLC10A3 cdna clone
Sequence
atggtgttaatgcaggacaagggcagctctcagcagtggcctggtctggggggcgagggtggtggcacaggtcccttaagcatgctcagagctgccctgctgctcatcagcctgccatggggggcccaagggacagccagcaccagcctcagcactgctgggggtcacaccgtgccaccgactgggggccgctacttgagcattggagatggctctgtgatggagtttgagtttcctgaggacagtgagggcatcatcgtgatctccagccagtacccaggccaggccaacaggacggcgcctggccccatgctcagggtcacctccctggacacagaggtgctgaccatcaagaacctcgtggacgcccatgaggccccgcccacactgattgaggagcggagagacttctgcatcaaggtctcacctgctgaagacacgcctgccaccctcagcgccgacctggcccacttctcggaaaacccaatcctctacctgctcctgcctcttatctttgtcaacaagtgttcgtttgggtgcaaagtggaactcgaggttctgaaggggctcatgcagagcccccagcccatgctgctgggcctcctgggccagtttctggtcatgcccttgtacgctttcctcatggccaaggtcttcatgctgcccaaggccctggctctgggcctcatcatcacctgctcgtcgcctggcggcggggggagctacctcttcagcctccttcttggaggggacgtcaccctggccatctccatgactttcctctctacggtggctgccactggcttcttgcctctgtcttcggccatctacagccgcctgctcagcatccatgagacgctccacgtgcccatctccaagatcctggggaccctgctgttcattgccatccccatagccgtgggcgtgctgatcaagtccaagctccccaagttctcccagctgctgctgcaggtcgtcaagcccttcagctttgtgctcctcctgggcggcctcttcctggcctatcgcatgggggtcttcatcctggcaggcatccggctacccatcgtactggtgggtatcacggtgcccctggttggcctgttggtgggctactgcctagccacgtgtctgaagctgccagtggcccagcggcggacggtcagcattgaggtaggggtgcagaacagcctgctggccttggccatgctgcagctatccctccgccgccttcaagctgactatgcctcccaggcccccttcattgtggcgctgagcggcacctccgagatgctggccttggtcattggccacttcatctacagcagcctgttcccagttccctga
Sequence Length
1347
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,549 Da
NCBI Official Full Name
Homo sapiens solute carrier family 10 (sodium/bile acid cotransporter family), member 3, mRNA
NCBI Official Synonym Full Names
solute carrier family 10 member 3
NCBI Official Symbol
SLC10A3
NCBI Official Synonym Symbols
P3; DXS253E
NCBI Protein Information
P3 protein
UniProt Protein Name
P3 protein
Protein Family
UniProt Gene Name
SLC10A3
UniProt Synonym Gene Names
DXS253E; P3
UniProt Entry Name
P3_HUMAN
NCBI Description
This gene maps to a GC-rich region of the X chromosome and was identified by its proximity to a CpG island. It is thought to be a housekeeping gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2008]
Uniprot Description
SLC10A3: The ubiquitous expression and the conservation of the sequence in distant animal species suggest that the gene codes for a protein with housekeeping functions. Belongs to the bile acid:sodium symporter (BASS) (TC 2.A.28) family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: Xq28
Cellular Component: integral to plasma membrane
Molecular Function: bile acid:sodium symporter activity
Similar Products
Product Notes
The SLC10A3 slc10a3 (Catalog #AAA1271676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgttaa tgcaggacaa gggcagctct cagcagtggc ctggtctggg gggcgagggt ggtggcacag gtcccttaag catgctcaga gctgccctgc tgctcatcag cctgccatgg ggggcccaag ggacagccag caccagcctc agcactgctg ggggtcacac cgtgccaccg actgggggcc gctacttgag cattggagat ggctctgtga tggagtttga gtttcctgag gacagtgagg gcatcatcgt gatctccagc cagtacccag gccaggccaa caggacggcg cctggcccca tgctcagggt cacctccctg gacacagagg tgctgaccat caagaacctc gtggacgccc atgaggcccc gcccacactg attgaggagc ggagagactt ctgcatcaag gtctcacctg ctgaagacac gcctgccacc ctcagcgccg acctggccca cttctcggaa aacccaatcc tctacctgct cctgcctctt atctttgtca acaagtgttc gtttgggtgc aaagtggaac tcgaggttct gaaggggctc atgcagagcc cccagcccat gctgctgggc ctcctgggcc agtttctggt catgcccttg tacgctttcc tcatggccaa ggtcttcatg ctgcccaagg ccctggctct gggcctcatc atcacctgct cgtcgcctgg cggcgggggg agctacctct tcagcctcct tcttggaggg gacgtcaccc tggccatctc catgactttc ctctctacgg tggctgccac tggcttcttg cctctgtctt cggccatcta cagccgcctg ctcagcatcc atgagacgct ccacgtgccc atctccaaga tcctggggac cctgctgttc attgccatcc ccatagccgt gggcgtgctg atcaagtcca agctccccaa gttctcccag ctgctgctgc aggtcgtcaa gcccttcagc tttgtgctcc tcctgggcgg cctcttcctg gcctatcgca tgggggtctt catcctggca ggcatccggc tacccatcgt actggtgggt atcacggtgc ccctggttgg cctgttggtg ggctactgcc tagccacgtg tctgaagctg ccagtggccc agcggcggac ggtcagcatt gaggtagggg tgcagaacag cctgctggcc ttggccatgc tgcagctatc cctccgccgc cttcaagctg actatgcctc ccaggccccc ttcattgtgg cgctgagcgg cacctccgag atgctggcct tggtcattgg ccacttcatc tacagcagcc tgttcccagt tccctga. It is sometimes possible for the material contained within the vial of "SLC10A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
