Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLAMF7 cdna clone

SLAMF7 cDNA Clone

Gene Names
SLAMF7; 19A; CS1; CD319; CRACC
Synonyms
SLAMF7; SLAMF7 cDNA Clone; SLAMF7 cdna clone
Ordering
For Research Use Only!
Sequence
atggctggttccccaacatgcctcaccctcatctatatcctttggcagctcacagggtcagcagcctctggacccgtgaaagagctggtcggttccgttggtggggccgtgactttccccctgaagtccaaagtaaagcaagttgactctattgtctggaccttcaacacaacccctcttgtcaccatacagccagaagggggcactatcatagtgacccaaaatcgtaatagggagagagtagacttcccagatggaggctactccctgaagctcagcaaactgaagaagaatgactcagggatctactatgtggggatatacagctcatcactccagcagccctccacccaggagtacgtgctgcatgtctacgagcacctgtcaaagcctaaagtcaccatgggtctgcagagcaataagaatggcacctgtgtgaccaatctgacatgctgcatggaacatggggaagaggatgtgatttatacctggaaggccctggggcaagcagccaatgagtcccataatgggtccatcctccccatctcctggagatggggagaaagtgatatgaccttcatctgcgttgccaggaaccctgtcagcagaaacttctcaagccccatccttgccaggaagctctgtgaaggtgctgctgatgacccagattcctccatggtcctcctgtgtctcctgttggtgcccctcctgctcagtctctttgtactggggctatttctttggtttctgaagagagagagacaagaagagaacaatcctaaaggaagatccagcaaatacggtttactccactgtggaaataccgaaaaagatggaaaatccccactcactgctcacgatgccagacacaccaaggctatttgcctatga
Sequence Length
891
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,316 Da
NCBI Official Full Name
Homo sapiens SLAM family member 7, mRNA
NCBI Official Synonym Full Names
SLAM family member 7
NCBI Official Symbol
SLAMF7
NCBI Official Synonym Symbols
19A; CS1; CD319; CRACC
NCBI Protein Information
SLAM family member 7
UniProt Protein Name
SLAM family member 7
Protein Family
UniProt Gene Name
SLAMF7
UniProt Synonym Gene Names
CS1; CRACC
UniProt Entry Name
SLAF7_HUMAN

Uniprot Description

SLAMF7: Isoform 1 mediates NK cell activation through a SH2D1A- independent extracellular signal-regulated ERK-mediated pathway. May play a role in lymphocyte adhesion. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Immunoglobulin superfamily; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23.1-q24.1

Cellular Component: plasma membrane

Biological Process: regulation of immune response

Research Articles on SLAMF7

Similar Products

Product Notes

The SLAMF7 slamf7 (Catalog #AAA1273582) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctggtt ccccaacatg cctcaccctc atctatatcc tttggcagct cacagggtca gcagcctctg gacccgtgaa agagctggtc ggttccgttg gtggggccgt gactttcccc ctgaagtcca aagtaaagca agttgactct attgtctgga ccttcaacac aacccctctt gtcaccatac agccagaagg gggcactatc atagtgaccc aaaatcgtaa tagggagaga gtagacttcc cagatggagg ctactccctg aagctcagca aactgaagaa gaatgactca gggatctact atgtggggat atacagctca tcactccagc agccctccac ccaggagtac gtgctgcatg tctacgagca cctgtcaaag cctaaagtca ccatgggtct gcagagcaat aagaatggca cctgtgtgac caatctgaca tgctgcatgg aacatgggga agaggatgtg atttatacct ggaaggccct ggggcaagca gccaatgagt cccataatgg gtccatcctc cccatctcct ggagatgggg agaaagtgat atgaccttca tctgcgttgc caggaaccct gtcagcagaa acttctcaag ccccatcctt gccaggaagc tctgtgaagg tgctgctgat gacccagatt cctccatggt cctcctgtgt ctcctgttgg tgcccctcct gctcagtctc tttgtactgg ggctatttct ttggtttctg aagagagaga gacaagaaga gaacaatcct aaaggaagat ccagcaaata cggtttactc cactgtggaa ataccgaaaa agatggaaaa tccccactca ctgctcacga tgccagacac accaaggcta tttgcctatg a. It is sometimes possible for the material contained within the vial of "SLAMF7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.