Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SKAP1 cdna clone

SKAP1 cDNA Clone

Gene Names
SKAP1; SCAP1; SKAP55; HEL-S-81p
Synonyms
SKAP1; SKAP1 cDNA Clone; SKAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggccgccgccctccctgaggagatccgttggctcctggaagatgctgaagagtttctggcagaaggtttgcggaatgagaacctcagcgctgttgcaagggatcacagagaccatattctacggggctttcagcaaatcaaagccaggtactattgggattttcagccccaagggggagacattggacaggacagctctgatgataatcacagcgggactcttggcctgtccctcacatccgatgcaccctttttgtcagattatcaggatgagggaatggaagacatcgtaaaaggagctcaagaacttgataacgtaatcaagcaaggatacttggagaagaaaagcaaagatcatagtttctttggatcggagtggcagaagcgatggtgtgttgtcagcagaggtctcttctactactatgctaatgagaagagcaagcagcccaaagggaccttcctcattaagggctacggtgtacggatggccccccacctgcgaagagattccaagaaagaatcctgctttgaactgacctcccaggataggcgcagctatgagtttacagctactagtccagcagaagccagagactgggtggatcaaataagtttcttgttaaaggatctgagctccttaaccattccatatgaagaggatgaggaggaagaagaaaaagaagagacatatgatgatattgatggttttgactccccaagttgtggttcccagtgcagacccactatcttgcctgggagtgtggggataaaagagcctacagaggagaaagaagaagaagatatttatgaagtcttgccagatgaagagcatgatctagaagaggatgagagtggcactcgacgaaaaggagactatgccagttactaccagggcctatgggattgccatggtgaccagccagatgaactgtccttccaacggggtgacctcatccgtattctgagcaaggagtataacatgtatggctggtgggtgggagaactgaacagcctcgttgggattgttccaaaggagtatctcaccactgcctttgaagtggaagaaagatga
Sequence Length
1077
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,333 Da
NCBI Official Full Name
Homo sapiens src kinase associated phosphoprotein 1, mRNA
NCBI Official Synonym Full Names
src kinase associated phosphoprotein 1
NCBI Official Symbol
SKAP1
NCBI Official Synonym Symbols
SCAP1; SKAP55; HEL-S-81p
NCBI Protein Information
src kinase-associated phosphoprotein 1
UniProt Protein Name
Src kinase-associated phosphoprotein 1
UniProt Gene Name
SKAP1
UniProt Synonym Gene Names
SCAP1; SKAP55; SKAP-55; pp55
UniProt Entry Name
SKAP1_HUMAN

NCBI Description

This gene encodes a T cell adaptor protein, a class of intracellular molecules with modular domains capable of recruiting additional proteins but that exhibit no intrinsic enzymatic activity. The encoded protein contains a unique N-terminal region followed by a PH domain and C-terminal SH3 domain. Along with the adhesion and degranulation-promoting adaptor protein, the encoded protein plays a critical role in inside-out signaling by coupling T-cell antigen receptor stimulation to the activation of integrins. [provided by RefSeq, Jul 2008]

Uniprot Description

SKAP55: Positively regulates T-cell receptor signaling by enhancing the MAP kinase pathway. Required for optimal conjugation between T-cells and antigen-presenting cells by promoting the clustering of integrin ITGAL on the surface of T-cells. May be involved in high affinity immunoglobulin epsilon receptor signaling in mast cells. Belongs to the SKAP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 17q21.32

Cellular Component: cytoplasm; nucleus; plasma membrane

Molecular Function: protein binding; protein kinase binding; protein phosphatase binding; SH2 domain binding; SH3 domain binding; SH3/SH2 adaptor activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; T cell receptor signaling pathway

Research Articles on SKAP1

Similar Products

Product Notes

The SKAP1 skap1 (Catalog #AAA1274917) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggccg ccgccctccc tgaggagatc cgttggctcc tggaagatgc tgaagagttt ctggcagaag gtttgcggaa tgagaacctc agcgctgttg caagggatca cagagaccat attctacggg gctttcagca aatcaaagcc aggtactatt gggattttca gccccaaggg ggagacattg gacaggacag ctctgatgat aatcacagcg ggactcttgg cctgtccctc acatccgatg cacccttttt gtcagattat caggatgagg gaatggaaga catcgtaaaa ggagctcaag aacttgataa cgtaatcaag caaggatact tggagaagaa aagcaaagat catagtttct ttggatcgga gtggcagaag cgatggtgtg ttgtcagcag aggtctcttc tactactatg ctaatgagaa gagcaagcag cccaaaggga ccttcctcat taagggctac ggtgtacgga tggcccccca cctgcgaaga gattccaaga aagaatcctg ctttgaactg acctcccagg ataggcgcag ctatgagttt acagctacta gtccagcaga agccagagac tgggtggatc aaataagttt cttgttaaag gatctgagct ccttaaccat tccatatgaa gaggatgagg aggaagaaga aaaagaagag acatatgatg atattgatgg ttttgactcc ccaagttgtg gttcccagtg cagacccact atcttgcctg ggagtgtggg gataaaagag cctacagagg agaaagaaga agaagatatt tatgaagtct tgccagatga agagcatgat ctagaagagg atgagagtgg cactcgacga aaaggagact atgccagtta ctaccagggc ctatgggatt gccatggtga ccagccagat gaactgtcct tccaacgggg tgacctcatc cgtattctga gcaaggagta taacatgtat ggctggtggg tgggagaact gaacagcctc gttgggattg ttccaaagga gtatctcacc actgcctttg aagtggaaga aagatga. It is sometimes possible for the material contained within the vial of "SKAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.