Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIGLEC5 cdna clone

SIGLEC5 cDNA Clone

Gene Names
SIGLEC5; CD170; OBBP2; CD33L2; OB-BP2; SIGLEC-5
Synonyms
SIGLEC5; SIGLEC5 cDNA Clone; SIGLEC5 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcccctgctgctgctgcccctgctgtggggggggtccctgcaggagaagccagtgtacgagctgcaagtgcagaagtcggtgacggtgcaggagggcctgtgcgtccttgtgccctgctccttctcttacccctggagatcctggtattcctctcccccactctacgtctactggttccgggacggggagatcccatactacgctgaggttgtggccacaaacaacccagacagaagagtgaagccagagacccagggccgattccgcctccttggggatgtccagaagaagaactgctccctgagcatcggagatgccagaatggaggacacgggaagctatttcttccgcgtggagagaggaagggatgtaaaatatagctaccaacagaataagctgaacttggaggtgacagccctgatagagaaacccgacatccactttctggagcctctggagtccggccgccccacaaggctgagctgcagccttccaggatcctgtgaagcgggaccacctctcacattctcctggacggggaatgccctcagccccctggaccccgagaccacccgctcctcggagctcaccctcacccccaggcccgaggaccatggcaccaacctcacctgtcagatgaaacgccaaggagctcaggtgaccacggagagaactgtccagctcaatgtctcctatgcaccacagaccatcaccatcttcaggaacggcatagccctagagatcctgcaaaacacctcataccttccggtcctggagggccaggctctgcggctgctctgtgatgctcccagcaacccccctgcacacctgagctggttccagggctcccctgccctgaacgccacccccatctccaataccgggatcttggagcttcgtcgagtaaggtctgcagaagaaggaggcttcacctgccgcgctcagcacccgctgggcttcctgcaaatttttctgaatctctcagtttactccctcccacagttgctgggcccctcctgctcctgggaggctgagggtctgcactgcagatgctcctttcgagcccggccggccccctccctgtgctggcggcttgaggagaagccgctggaggggaacagcagccagggctcattcaaggtcaactccagctcagctgggccctgggccaacagctccctgatcctccacggggggctcagctccgacctcaaagtcagctgcaaggcctggaacatctatgggtcccagagcggctctgtcctgctgctgcaagggagatcgaaccttgggacaggagtggttcctgcagcccttggtggtgctggtgtcatggccctgctctgtatctgtctgtgcctcatcttctttttaatagtgaaagcccgcaggaagcaagcagctgggagaccagagaaaatggatgatgaagaccccattatgggtaccatcacctcgggttccaggaagaagccctggccagacagcgccggagatcaagcatctcctcctggggatgcccctcccttggaagaacaaaaggagctccattatgcctcccttagtttttctgagatgaagtcgagggagcctaaggaccaggaggccccaagcaccacggagtactcggagatcaagacaagcaagtga
Sequence Length
1656
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,715 Da
NCBI Official Full Name
Homo sapiens sialic acid binding Ig-like lectin 5, mRNA
NCBI Official Synonym Full Names
sialic acid binding Ig like lectin 5
NCBI Official Symbol
SIGLEC5
NCBI Official Synonym Symbols
CD170; OBBP2; CD33L2; OB-BP2; SIGLEC-5
NCBI Protein Information
sialic acid-binding Ig-like lectin 5
UniProt Protein Name
Sialic acid-binding Ig-like lectin 5
UniProt Gene Name
SIGLEC5
UniProt Synonym Gene Names
CD33L2; OBBP2; Siglec-5; OB-BP2; OB-binding protein 2
UniProt Entry Name
SIGL5_HUMAN

NCBI Description

This gene encodes a member of the sialic acid-binding immunoglobulin-like lectin (Siglec) family. These cell surface lectins are characterized by structural motifs in the immunoglobulin (Ig)-like domains and sialic acid recognition sites in the first Ig V set domain. The encoded protein is a member of the CD33-related subset of Siglecs and inhibits the activation of several cell types including monocytes, macrophages and neutrophils. Binding of group B Streptococcus (GBS) to the encoded protein plays a role in GBS immune evasion. [provided by RefSeq, Feb 2012]

Uniprot Description

SIGLEC5: Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Binds equally to alpha-2,3-linked and alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.

Protein type: Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.3

Molecular Function: protein binding

Research Articles on SIGLEC5

Similar Products

Product Notes

The SIGLEC5 siglec5 (Catalog #AAA1272272) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcccc tgctgctgct gcccctgctg tggggggggt ccctgcagga gaagccagtg tacgagctgc aagtgcagaa gtcggtgacg gtgcaggagg gcctgtgcgt ccttgtgccc tgctccttct cttacccctg gagatcctgg tattcctctc ccccactcta cgtctactgg ttccgggacg gggagatccc atactacgct gaggttgtgg ccacaaacaa cccagacaga agagtgaagc cagagaccca gggccgattc cgcctccttg gggatgtcca gaagaagaac tgctccctga gcatcggaga tgccagaatg gaggacacgg gaagctattt cttccgcgtg gagagaggaa gggatgtaaa atatagctac caacagaata agctgaactt ggaggtgaca gccctgatag agaaacccga catccacttt ctggagcctc tggagtccgg ccgccccaca aggctgagct gcagccttcc aggatcctgt gaagcgggac cacctctcac attctcctgg acggggaatg ccctcagccc cctggacccc gagaccaccc gctcctcgga gctcaccctc acccccaggc ccgaggacca tggcaccaac ctcacctgtc agatgaaacg ccaaggagct caggtgacca cggagagaac tgtccagctc aatgtctcct atgcaccaca gaccatcacc atcttcagga acggcatagc cctagagatc ctgcaaaaca cctcatacct tccggtcctg gagggccagg ctctgcggct gctctgtgat gctcccagca acccccctgc acacctgagc tggttccagg gctcccctgc cctgaacgcc acccccatct ccaataccgg gatcttggag cttcgtcgag taaggtctgc agaagaagga ggcttcacct gccgcgctca gcacccgctg ggcttcctgc aaatttttct gaatctctca gtttactccc tcccacagtt gctgggcccc tcctgctcct gggaggctga gggtctgcac tgcagatgct cctttcgagc ccggccggcc ccctccctgt gctggcggct tgaggagaag ccgctggagg ggaacagcag ccagggctca ttcaaggtca actccagctc agctgggccc tgggccaaca gctccctgat cctccacggg gggctcagct ccgacctcaa agtcagctgc aaggcctgga acatctatgg gtcccagagc ggctctgtcc tgctgctgca agggagatcg aaccttggga caggagtggt tcctgcagcc cttggtggtg ctggtgtcat ggccctgctc tgtatctgtc tgtgcctcat cttcttttta atagtgaaag cccgcaggaa gcaagcagct gggagaccag agaaaatgga tgatgaagac cccattatgg gtaccatcac ctcgggttcc aggaagaagc cctggccaga cagcgccgga gatcaagcat ctcctcctgg ggatgcccct cccttggaag aacaaaagga gctccattat gcctccctta gtttttctga gatgaagtcg agggagccta aggaccagga ggccccaagc accacggagt actcggagat caagacaagc aagtga. It is sometimes possible for the material contained within the vial of "SIGLEC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.