Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SHFM1 cdna clone

SHFM1 cDNA Clone

Gene Names
SHFM1; ECD; DSS1; SEM1; SHFD1; SHSF1; Shfdg1
Synonyms
SHFM1; SHFM1 cDNA Clone; SHFM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcagagaaaaagcagccggtagacttaggtctgttagaggaagacgacgagtttgaagagttccctgccgaagactgggctggcttagatgaagatgaagatgcacatgtctgggaggataattgggatgatgacaatgtagaggatgacttctctaatcagttacgagctgaactagagaaacatggttataagatggagacttcatag
Sequence Length
213
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,278 Da
NCBI Official Full Name
Homo sapiens split hand/foot malformation (ectrodactyly) type 1, mRNA
NCBI Official Synonym Full Names
split hand/foot malformation (ectrodactyly) type 1
NCBI Official Symbol
SHFM1
NCBI Official Synonym Symbols
ECD; DSS1; SEM1; SHFD1; SHSF1; Shfdg1
NCBI Protein Information
26S proteasome complex subunit DSS1
UniProt Protein Name
26S proteasome complex subunit DSS1
Protein Family
UniProt Gene Name
SHFM1
UniProt Synonym Gene Names
DSS1; SHFDG1
UniProt Entry Name
DSS1_HUMAN

NCBI Description

The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]

Uniprot Description

SHFM1: Subunit of the 26S proteasome which plays a role in ubiquitin-dependent proteolysis. Belongs to the DSS1/SEM1 family.

Protein type: Protease; DNA repair, damage; Proteasome complex

Chromosomal Location of Human Ortholog: 7q21.3

Cellular Component: integrator complex; proteasome complex

Molecular Function: protein binding

Biological Process: double-strand break repair via homologous recombination; proteolysis

Disease: Split-hand/foot Malformation 1

Research Articles on SHFM1

Similar Products

Product Notes

The SHFM1 shfm1 (Catalog #AAA1269290) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcagaga aaaagcagcc ggtagactta ggtctgttag aggaagacga cgagtttgaa gagttccctg ccgaagactg ggctggctta gatgaagatg aagatgcaca tgtctgggag gataattggg atgatgacaa tgtagaggat gacttctcta atcagttacg agctgaacta gagaaacatg gttataagat ggagacttca tag. It is sometimes possible for the material contained within the vial of "SHFM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.