Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SH3GL1 cdna clone

SH3GL1 cDNA Clone

Gene Names
SH3GL1; EEN; CNSA1; SH3P8; SH3D2B
Synonyms
SH3GL1; SH3GL1 cDNA Clone; SH3GL1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggtggcggggctgaagaagcagttctacaaggcgagccagctggtcagtgagaaggtcggaggggccgaggggaccaagctggatgatgacttcaaagagatggagaagaaggtggatgtcaccagcaaggcggtgacagaagtgctggccaggaccatcgagtacctgcagcccaacccagcctcgcgggctaagctgaccatgctcaacacggtgtccaagatccggggccaggtgaagaaccccggctacccgcagtcggaggggcttctgggcgagtgcatgatccgccacgggaaggagctgggcggcgagtccaactttggtgacgcattgctggatgccggcgagtccatgaagcgcctggcagaggtgaaggactccctggacatcgaggtcaagcagaacttcattgaccccctccagaacctgtgcgagaaagacctgaaggagatccagcaccacctgaagaaactggagggccgccgcctggactttgactacaagaagaagcggcagggcaagatccccgatgaggagctacgccaggcgctggagaagttcgaggagtccaaggaggtggcagaaaccagcatgcacaacctcctggagactgacatcgagcaggtgagtcagctctcggccctggtggatgcacagctggactaccaccggcaggccgtgcagatcctggacgagctggcggagaagctcaagcgcaggatgcgggaagcttcctcacgccctaagcgggagtataagccgaagccccgggagccctttgaccttggagagcctgagcagtccaacgggggcttcccctgcaccacagcccccaagatcgcagcttcatcgtctttccgatcttccgacaagcccatccggacccctagccggagcatgccgcccctggaccagccgagctgcaaggcgctgtacgacttcgagcccgagaacgacggggagctgggcttccatgagggcgacgtcatcacgctgaccaaccagatcgatgagaactggtacgagggcatgctggacggccagtcgggcttcttcccgctcagctacgtggaggtgcttgtgcccctgccgcagtga
Sequence Length
1107
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,519 Da
NCBI Official Full Name
Homo sapiens SH3-domain GRB2-like 1, mRNA
NCBI Official Synonym Full Names
SH3 domain containing GRB2 like 1, endophilin A2
NCBI Official Symbol
SH3GL1
NCBI Official Synonym Symbols
EEN; CNSA1; SH3P8; SH3D2B
NCBI Protein Information
endophilin-A2
UniProt Protein Name
Endophilin-A2
Protein Family
UniProt Gene Name
SH3GL1
UniProt Synonym Gene Names
CNSA1; SH3D2B; EEN
UniProt Entry Name
SH3G1_HUMAN

NCBI Description

This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]

Uniprot Description

SH3GL1: Implicated in endocytosis. May recruit other proteins to membranes with high curvature. In some cases of acute leukemia, a translocation results in the formation of a MLL-EEN fusion gene. Belongs to the endophilin family.

Protein type: Vesicle; Oncoprotein

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cell-cell adherens junction; cytoplasm

Molecular Function: identical protein binding; protein binding

Biological Process: central nervous system development; signal transduction

Disease: Leukemia, Acute Myeloid

Research Articles on SH3GL1

Similar Products

Product Notes

The SH3GL1 sh3gl1 (Catalog #AAA1276416) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggtgg cggggctgaa gaagcagttc tacaaggcga gccagctggt cagtgagaag gtcggagggg ccgaggggac caagctggat gatgacttca aagagatgga gaagaaggtg gatgtcacca gcaaggcggt gacagaagtg ctggccagga ccatcgagta cctgcagccc aacccagcct cgcgggctaa gctgaccatg ctcaacacgg tgtccaagat ccggggccag gtgaagaacc ccggctaccc gcagtcggag gggcttctgg gcgagtgcat gatccgccac gggaaggagc tgggcggcga gtccaacttt ggtgacgcat tgctggatgc cggcgagtcc atgaagcgcc tggcagaggt gaaggactcc ctggacatcg aggtcaagca gaacttcatt gaccccctcc agaacctgtg cgagaaagac ctgaaggaga tccagcacca cctgaagaaa ctggagggcc gccgcctgga ctttgactac aagaagaagc ggcagggcaa gatccccgat gaggagctac gccaggcgct ggagaagttc gaggagtcca aggaggtggc agaaaccagc atgcacaacc tcctggagac tgacatcgag caggtgagtc agctctcggc cctggtggat gcacagctgg actaccaccg gcaggccgtg cagatcctgg acgagctggc ggagaagctc aagcgcagga tgcgggaagc ttcctcacgc cctaagcggg agtataagcc gaagccccgg gagccctttg accttggaga gcctgagcag tccaacgggg gcttcccctg caccacagcc cccaagatcg cagcttcatc gtctttccga tcttccgaca agcccatccg gacccctagc cggagcatgc cgcccctgga ccagccgagc tgcaaggcgc tgtacgactt cgagcccgag aacgacgggg agctgggctt ccatgagggc gacgtcatca cgctgaccaa ccagatcgat gagaactggt acgagggcat gctggacggc cagtcgggct tcttcccgct cagctacgtg gaggtgcttg tgcccctgcc gcagtga. It is sometimes possible for the material contained within the vial of "SH3GL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.