Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SH3BP5L cdna clone

SH3BP5L cDNA Clone

Synonyms
SH3BP5L; SH3BP5L cDNA Clone; SH3BP5L cdna clone
Ordering
For Research Use Only!
Sequence
atggctgagctcagacaggttccaggagggcgggagaccccacagggggagctgcggcctgaagttgtagaggatgaagtccctaggagcccagtcgcagaagagcctggaggaggtggaagcagcagcagtgaggccaaattgtccccaagagaggaggaagaactggatcctagaatacaggaggagttggagcacctgaaccaggccagcgaggagatcaaccaggtggaactacagctggatgaggccaggaccacctatcggaggatcctacaggagtcggcgaggaaactgaatacacagggttcccacttggggagctgcatcgagaaagcccggccctactatgaggctcggcggctggctaaggaggctcagcaggagacacagaaggcagcgctgcggtacgagcgggccgtaagcatgcacaacgctgctcgagaaatggtgtttgtggctgagcagggcgtcatggctgacaagaaccgactggaccccacgtggcaggagatgctgaaccatgctacctgcaaggtgaatgaggcggaggaagagcggcttcgaggtgagcgggagcaccagcgagtgactcggctgtgccaacaggctgaggctcgggtccaagccctgcagaagaccctccggagggccatcggcaagagccgcccctactttgagctcaaggcccagttcagccagatcctggaggagcacaaggccaaggtgacagaactggagcagcaggtagctcaggccaagacgcgctactccgtggcccttcgtaacctggagcagatcagcgagcagattcacgcacggcgccgcgggggtctgcctccccaccccctgggccctcggcgctcctcccccgtgggggccgaggcaggacccgaggacatggaggacggagacagcgggattgagggggccgagggtgcggggctggaggagggcagcagcctggggcccggccccgcccccgacaccgataccctgagtctgctgagcctgcgcacggtggcttcagacctgcagaagtgcgactccgtggagcacttgcgaggcctctcggaccacgtcagtctggacggccaagagctgggaacgcggagtggagggcgccggggcagcgacggcggagcccgtgggggtcggcaccagcgcagcgtcagcctgtag
Sequence Length
1182
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,500 Da
NCBI Official Full Name
Homo sapiens SH3-binding domain protein 5-like, mRNA
NCBI Official Synonym Full Names
SH3 binding domain protein 5 like
NCBI Official Symbol
SH3BP5L
NCBI Protein Information
SH3 domain-binding protein 5-like
UniProt Protein Name
SH3 domain-binding protein 5-like
UniProt Gene Name
SH3BP5L
UniProt Synonym Gene Names
KIAA1720; SH3BP-5-like
UniProt Entry Name
3BP5L_HUMAN

Uniprot Description

SH3BP5L: Belongs to the SH3BP5 family.

Chromosomal Location of Human Ortholog: 1q44

Cellular Component: cytoplasm

Molecular Function: protein kinase inhibitor activity; SH3 domain binding

Similar Products

Product Notes

The SH3BP5L sh3bp5l (Catalog #AAA1274026) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgagc tcagacaggt tccaggaggg cgggagaccc cacaggggga gctgcggcct gaagttgtag aggatgaagt ccctaggagc ccagtcgcag aagagcctgg aggaggtgga agcagcagca gtgaggccaa attgtcccca agagaggagg aagaactgga tcctagaata caggaggagt tggagcacct gaaccaggcc agcgaggaga tcaaccaggt ggaactacag ctggatgagg ccaggaccac ctatcggagg atcctacagg agtcggcgag gaaactgaat acacagggtt cccacttggg gagctgcatc gagaaagccc ggccctacta tgaggctcgg cggctggcta aggaggctca gcaggagaca cagaaggcag cgctgcggta cgagcgggcc gtaagcatgc acaacgctgc tcgagaaatg gtgtttgtgg ctgagcaggg cgtcatggct gacaagaacc gactggaccc cacgtggcag gagatgctga accatgctac ctgcaaggtg aatgaggcgg aggaagagcg gcttcgaggt gagcgggagc accagcgagt gactcggctg tgccaacagg ctgaggctcg ggtccaagcc ctgcagaaga ccctccggag ggccatcggc aagagccgcc cctactttga gctcaaggcc cagttcagcc agatcctgga ggagcacaag gccaaggtga cagaactgga gcagcaggta gctcaggcca agacgcgcta ctccgtggcc cttcgtaacc tggagcagat cagcgagcag attcacgcac ggcgccgcgg gggtctgcct ccccaccccc tgggccctcg gcgctcctcc cccgtggggg ccgaggcagg acccgaggac atggaggacg gagacagcgg gattgagggg gccgagggtg cggggctgga ggagggcagc agcctggggc ccggccccgc ccccgacacc gataccctga gtctgctgag cctgcgcacg gtggcttcag acctgcagaa gtgcgactcc gtggagcact tgcgaggcct ctcggaccac gtcagtctgg acggccaaga gctgggaacg cggagtggag ggcgccgggg cagcgacggc ggagcccgtg ggggtcggca ccagcgcagc gtcagcctgt ag. It is sometimes possible for the material contained within the vial of "SH3BP5L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.