Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SH3BP5 cdna clone

SH3BP5 cDNA Clone

Gene Names
SH3BP5; SAB; SH3BP-5
Synonyms
SH3BP5; SH3BP5 cDNA Clone; SH3BP5 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcaggggctggaggaggaagaagaggtggatccccggatccagggagaactggagaagttaaatcagtccacggatgatatcaacagacgggagactgaacttgaggatgctcgtcagaagttccgctctgttctggttgaagcaacggtgaaactggatgaactggtgaagaaaattggcaaagctgtggaagactccaagccctactgggaggcacggagggtggcgaggcaggctcagctggaagctcagaaagccacgcaggacttccagagggccacagaggtgctccgtgccgccaaggagaccatctccctggccgagcagcggctgctggaggatgacaagcggcagttcgactccgcctggcaggagatgctgaatcacgccactcagagggtcatggaggcggagcagaccaagaccaggagcgagctggtgcataaggagacggcagccaggtacaatgccgccatgggccgcatgcgacagctggagaagaaactcaagagagccatcaacaagtccaagccttattttgaactcaaggcaaagtactatgtgcagctcgagcaactgaaaaagactgtggatgacctgcaggccaaactgaccctggcaaaaggcgagtacaagatggccctgaagaacctggagatgatctcagatgagatccacgagcggcggcgctccagtgccatggggcctcggggatgcggtgttggtgctgagggcagcagcacatctgtggaggatctgccagggagcaaacctgagcctgatgccatttctgtggcctcggaggcctttgaagatgacagctgtagcaactttgtgtctgaagatgactcggaaacccagtccgtgtccagctttagttcaggaccaacaagcccgtctgagatgcctgaccagttccctgcggttgtgaggcctggcagcctggatctgcccagccctgtgtccctgtcagagtttgggatgatgttcccagtgttgggccctcgaagtgaatgcagcggggcctcctcccctgaatgtgaagtagaacgaggagacagggcagaaggggcagagaataaaacaagtgacaaagccaacaacaaccggggcctcagcagtagcagtggcagtggtggcagcagtaagagccaaagcagcacctcccctgagggccaggccttggagaaccggatgaagcagctctccctacagtgctcaaagggaagagatggaattattgctgacataaaaatggtgcagattggctga
Sequence Length
1278
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,202 Da
NCBI Official Full Name
Homo sapiens SH3-domain binding protein 5 (BTK-associated), mRNA
NCBI Official Synonym Full Names
SH3 domain binding protein 5
NCBI Official Symbol
SH3BP5
NCBI Official Synonym Symbols
SAB; SH3BP-5
NCBI Protein Information
SH3 domain-binding protein 5
UniProt Protein Name
SH3 domain-binding protein 5
UniProt Gene Name
SH3BP5
UniProt Synonym Gene Names
SAB; SH3BP-5
UniProt Entry Name
3BP5_HUMAN

Uniprot Description

SH3BP5: Inhibits the auto- and transphosphorylation activity of BTK. Plays a negative regulatory role in BTK-related cytoplasmic signaling in B-cells. May be involved in BCR-induced apoptotic cell death. Belongs to the SH3BP5 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 3p24.3

Cellular Component: cytoplasm

Molecular Function: protein binding; protein kinase inhibitor activity; SH3 domain binding

Biological Process: signal transduction

Research Articles on SH3BP5

Similar Products

Product Notes

The SH3BP5 sh3bp5 (Catalog #AAA1277896) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcagg ggctggagga ggaagaagag gtggatcccc ggatccaggg agaactggag aagttaaatc agtccacgga tgatatcaac agacgggaga ctgaacttga ggatgctcgt cagaagttcc gctctgttct ggttgaagca acggtgaaac tggatgaact ggtgaagaaa attggcaaag ctgtggaaga ctccaagccc tactgggagg cacggagggt ggcgaggcag gctcagctgg aagctcagaa agccacgcag gacttccaga gggccacaga ggtgctccgt gccgccaagg agaccatctc cctggccgag cagcggctgc tggaggatga caagcggcag ttcgactccg cctggcagga gatgctgaat cacgccactc agagggtcat ggaggcggag cagaccaaga ccaggagcga gctggtgcat aaggagacgg cagccaggta caatgccgcc atgggccgca tgcgacagct ggagaagaaa ctcaagagag ccatcaacaa gtccaagcct tattttgaac tcaaggcaaa gtactatgtg cagctcgagc aactgaaaaa gactgtggat gacctgcagg ccaaactgac cctggcaaaa ggcgagtaca agatggccct gaagaacctg gagatgatct cagatgagat ccacgagcgg cggcgctcca gtgccatggg gcctcgggga tgcggtgttg gtgctgaggg cagcagcaca tctgtggagg atctgccagg gagcaaacct gagcctgatg ccatttctgt ggcctcggag gcctttgaag atgacagctg tagcaacttt gtgtctgaag atgactcgga aacccagtcc gtgtccagct ttagttcagg accaacaagc ccgtctgaga tgcctgacca gttccctgcg gttgtgaggc ctggcagcct ggatctgccc agccctgtgt ccctgtcaga gtttgggatg atgttcccag tgttgggccc tcgaagtgaa tgcagcgggg cctcctcccc tgaatgtgaa gtagaacgag gagacagggc agaaggggca gagaataaaa caagtgacaa agccaacaac aaccggggcc tcagcagtag cagtggcagt ggtggcagca gtaagagcca aagcagcacc tcccctgagg gccaggcctt ggagaaccgg atgaagcagc tctccctaca gtgctcaaag ggaagagatg gaattattgc tgacataaaa atggtgcaga ttggctga. It is sometimes possible for the material contained within the vial of "SH3BP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.