SGTB cdna clone
SGTB cDNA Clone
Gene Names
SGTB; SGT2
Synonyms
SGTB; SGTB cDNA Clone; SGTB cdna clone
Sequence
atgtcatctatcaagcacctggtttatgcagttattcgtttcttacgggaacaaagtcagatggacacttacacctcggatgaacaagaaagtttggaagttgcaattcagtgcttggagacagtttttaagatcagcccagaagatacacacctagcagtttcacagcctttgacagaaatgtttaccagttccttctgtaagaatgacgttctgcccctttcaaactcagtgcctgaagatgtgggaaaagctgaccaattaaaagatgaaggcaataaccacatgaaagaagaaaattatgctgctgcagtggattgttacacacaggcaatagaattggatcccaataatgcagtttactattgcaacagggctgctgctcagagcaaattaggtcactacacagatgcgataaaggattgtgaaaaagcaatagcaattgattcaaagtacagcaaggcctatgggagaatggggctggccctcactgccttgaataaatttgaagaagcagttacaagttatcaaaaggcattagatcttgaccctgaaaatgattcctataagtcaaatctgaaaatagcagaacagaagttaagagaggtatccagtcctacaggaactggactgagctttgacatggctagcttgataaataatccagccttcattagtatggcggcaagtttaatgcagaaccctcaagttcaacagctaatgtcaggaatgatgacaaatgccattgggggacctgctgctggagttgggggcctaactgacctgtcaagcctcatccaagcgggacagcagtttgctcagcagatacagcaacaaaatcctgaacttatagagcaactgagaaatcacatccggagcagatcattcagcagcagcgctgaagagcattcctga
Sequence Length
915
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,429 Da
NCBI Official Full Name
Homo sapiens small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta, mRNA
NCBI Official Synonym Full Names
small glutamine rich tetratricopeptide repeat containing beta
NCBI Official Symbol
SGTB
NCBI Official Synonym Symbols
SGT2
NCBI Protein Information
small glutamine-rich tetratricopeptide repeat-containing protein beta
UniProt Protein Name
Small glutamine-rich tetratricopeptide repeat-containing protein beta
UniProt Gene Name
SGTB
UniProt Synonym Gene Names
SGT2
UniProt Entry Name
SGTB_HUMAN
Uniprot Description
SGTB: contains three type 1 and three type 2 tetratricopeptide repeats.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 5q12.3
Molecular Function: protein binding
Similar Products
Product Notes
The SGTB sgtb (Catalog #AAA1275422) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcatcta tcaagcacct ggtttatgca gttattcgtt tcttacggga acaaagtcag atggacactt acacctcgga tgaacaagaa agtttggaag ttgcaattca gtgcttggag acagttttta agatcagccc agaagataca cacctagcag tttcacagcc tttgacagaa atgtttacca gttccttctg taagaatgac gttctgcccc tttcaaactc agtgcctgaa gatgtgggaa aagctgacca attaaaagat gaaggcaata accacatgaa agaagaaaat tatgctgctg cagtggattg ttacacacag gcaatagaat tggatcccaa taatgcagtt tactattgca acagggctgc tgctcagagc aaattaggtc actacacaga tgcgataaag gattgtgaaa aagcaatagc aattgattca aagtacagca aggcctatgg gagaatgggg ctggccctca ctgccttgaa taaatttgaa gaagcagtta caagttatca aaaggcatta gatcttgacc ctgaaaatga ttcctataag tcaaatctga aaatagcaga acagaagtta agagaggtat ccagtcctac aggaactgga ctgagctttg acatggctag cttgataaat aatccagcct tcattagtat ggcggcaagt ttaatgcaga accctcaagt tcaacagcta atgtcaggaa tgatgacaaa tgccattggg ggacctgctg ctggagttgg gggcctaact gacctgtcaa gcctcatcca agcgggacag cagtttgctc agcagataca gcaacaaaat cctgaactta tagagcaact gagaaatcac atccggagca gatcattcag cagcagcgct gaagagcatt cctga. It is sometimes possible for the material contained within the vial of "SGTB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
