SGSM3 cdna clone
SGSM3 cDNA Clone
Gene Names
SGSM3; MAP; CIP85; RUSC3; RUTBC3; RABGAP5; RabGAP-5; rabGAPLP
Synonyms
SGSM3; SGSM3 cDNA Clone; SGSM3 cdna clone
Sequence
atgtcaggaagccatacacctgcctgtggccctttctcagccctgactccgagcatatggccccaggagatcttggccaagtacacgcagaaggaagagtcagcagagcaaccagagttctactacgatgagtttggtttccgtgtgtacaaggaagaaggtgatgagcctggctccagtctgctggcgaactcccctctgatggaggatgctccacagaggctgcggtggcaggcccacctggagttcacccataaccacgatgtgggggatctcacctgggacaagattgccgtctccctaccccgctctgagaagctccgctccctggtgctggccggcatcccacatggcatgaggccacagctgtggatgcggctctctggggccctgcagaagaagaggaactctgagctgtcctaccgcgagattgtgaagaacagctccaacgatgagaccatcgctgccaagcagatcgagaaggacctgctccgcaccatgcccagcaacgcctgcttcgccagcatgggtagcatcggggtgccccgcctgcgcagggtgctccgggccctggcctggctctacccagagatcggctactgccagggcaccggcatggtggccgcctgcctcctgctgttcctggaggaggaggacgccttctggatgatgtctgccatcatcgaggacctgctccccgcctcctacttcagcaccaccctgctgggtgtccagactgaccagcgggtcctgcgccacctcattgtccagtacctgcctcgcctggacaagctgctccaggagcatgacattgagctgtccctgatcacactgcactggttcctcacggccttcgccagcgtggtggacatcaagctgctcctgcgcatctgggacctgtttttctacgagggctcccgggtgctgttccagctcacgctgggcatgctgcacctcaaggaggaagagctgatccagtcagagaactcggcctccatcttcaacacgctatcggatatcccgtcgcagatggaggacgcggagctgcttctgggggtggccatgcggctggccggctccctcaccgatgtggccgtggagactcagcgccgcaagcacctggcctatctcattgcagaccagggccagctcctgggggccggcaccctcaccaacctctctcaggttgttcgccgcaggacccagcggaggaagtccaccatcactgctctgctcttcggggaggatgacctggaggcactcaaggccaagaacatcaagcagacggaactggtggctgacctccgggaagccatcctgcgcgtggcacgccacttccagtgcacagaccccaaaaactgcagcgtggagctgactccagactatagcatggagagccaccagcgggaccacgagaactacgtggcgtgctcacgcagccaccggcgccgagccaaggccctgctggactttgagcggcacgacgacgacgagctgggcttccgcaagaacgacatcatcacaatcgtgtctcagaaggacgagcactgctgggtgggggagctcaacggcctgcgaggctggtttccagccaagttcgtggaagtcctggatgagcgcagcaaagagtactccatcgcgggggatgactcggtgacggagggggtcacagacctcgtgcgagggaccctctgcccggcccttaaggccctgttcgaacatggactgaagaagccatccctgcttgggggcgcctgccacccctggctgtttatcgaggaggctgcaggccgggaggtcgagagagactttgcctccgtgtattcccgtctggtgctctgtaagaccttcaggttggatgaagatggcaaagtcctgaccccggaggagctgctctaccgggctgtgcagtctgtgaacgtgacccacgatgcagtgcatgcacaaatggatgtgaagctccgctcactgatctgcgtggggctcaatgagcaggtgctgcacctgtggctggaggtgctctgctccagcctgcccaccgtggagaagtggtaccagccctggtccttcctgcgcagcccgggctgggtccagatcaagtgtgagctccgagtcctctgctgctttgccttcagcctctcccaggactgggagctccctgcgaagagagaggcgcagcagcccctgaaggagggcgtccgggacatgctggtgaagcaccacctcttcagctgggatgtggacgggtga
Sequence Length
2250
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
88,308 Da
NCBI Official Full Name
Homo sapiens small G protein signaling modulator 3, mRNA
NCBI Official Synonym Full Names
small G protein signaling modulator 3
NCBI Official Symbol
SGSM3
NCBI Official Synonym Symbols
MAP; CIP85; RUSC3; RUTBC3; RABGAP5; RabGAP-5; rabGAPLP
NCBI Protein Information
small G protein signaling modulator 3
UniProt Protein Name
Small G protein signaling modulator 3
Protein Family
UniProt Gene Name
SGSM3
UniProt Synonym Gene Names
RabGAPLP
UniProt Entry Name
SGSM3_HUMAN
Uniprot Description
SGSM3: May play a cooperative role in NF2-mediated growth suppression of cells. Belongs to the small G protein signaling modulator family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: G protein regulator, misc.
Chromosomal Location of Human Ortholog: 22q13.1-q13.2
Cellular Component: cytosol; endomembrane system
Molecular Function: GTPase activator activity; protein binding; Rab GTPase binding
Biological Process: intracellular protein transport; plasma membrane to endosome transport; Rap protein signal transduction; regulation of Rab protein signal transduction; regulation of vesicle fusion
Research Articles on SGSM3
Similar Products
Product Notes
The SGSM3 sgsm3 (Catalog #AAA1271244) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaggaa gccatacacc tgcctgtggc cctttctcag ccctgactcc gagcatatgg ccccaggaga tcttggccaa gtacacgcag aaggaagagt cagcagagca accagagttc tactacgatg agtttggttt ccgtgtgtac aaggaagaag gtgatgagcc tggctccagt ctgctggcga actcccctct gatggaggat gctccacaga ggctgcggtg gcaggcccac ctggagttca cccataacca cgatgtgggg gatctcacct gggacaagat tgccgtctcc ctaccccgct ctgagaagct ccgctccctg gtgctggccg gcatcccaca tggcatgagg ccacagctgt ggatgcggct ctctggggcc ctgcagaaga agaggaactc tgagctgtcc taccgcgaga ttgtgaagaa cagctccaac gatgagacca tcgctgccaa gcagatcgag aaggacctgc tccgcaccat gcccagcaac gcctgcttcg ccagcatggg tagcatcggg gtgccccgcc tgcgcagggt gctccgggcc ctggcctggc tctacccaga gatcggctac tgccagggca ccggcatggt ggccgcctgc ctcctgctgt tcctggagga ggaggacgcc ttctggatga tgtctgccat catcgaggac ctgctccccg cctcctactt cagcaccacc ctgctgggtg tccagactga ccagcgggtc ctgcgccacc tcattgtcca gtacctgcct cgcctggaca agctgctcca ggagcatgac attgagctgt ccctgatcac actgcactgg ttcctcacgg ccttcgccag cgtggtggac atcaagctgc tcctgcgcat ctgggacctg tttttctacg agggctcccg ggtgctgttc cagctcacgc tgggcatgct gcacctcaag gaggaagagc tgatccagtc agagaactcg gcctccatct tcaacacgct atcggatatc ccgtcgcaga tggaggacgc ggagctgctt ctgggggtgg ccatgcggct ggccggctcc ctcaccgatg tggccgtgga gactcagcgc cgcaagcacc tggcctatct cattgcagac cagggccagc tcctgggggc cggcaccctc accaacctct ctcaggttgt tcgccgcagg acccagcgga ggaagtccac catcactgct ctgctcttcg gggaggatga cctggaggca ctcaaggcca agaacatcaa gcagacggaa ctggtggctg acctccggga agccatcctg cgcgtggcac gccacttcca gtgcacagac cccaaaaact gcagcgtgga gctgactcca gactatagca tggagagcca ccagcgggac cacgagaact acgtggcgtg ctcacgcagc caccggcgcc gagccaaggc cctgctggac tttgagcggc acgacgacga cgagctgggc ttccgcaaga acgacatcat cacaatcgtg tctcagaagg acgagcactg ctgggtgggg gagctcaacg gcctgcgagg ctggtttcca gccaagttcg tggaagtcct ggatgagcgc agcaaagagt actccatcgc gggggatgac tcggtgacgg agggggtcac agacctcgtg cgagggaccc tctgcccggc ccttaaggcc ctgttcgaac atggactgaa gaagccatcc ctgcttgggg gcgcctgcca cccctggctg tttatcgagg aggctgcagg ccgggaggtc gagagagact ttgcctccgt gtattcccgt ctggtgctct gtaagacctt caggttggat gaagatggca aagtcctgac cccggaggag ctgctctacc gggctgtgca gtctgtgaac gtgacccacg atgcagtgca tgcacaaatg gatgtgaagc tccgctcact gatctgcgtg gggctcaatg agcaggtgct gcacctgtgg ctggaggtgc tctgctccag cctgcccacc gtggagaagt ggtaccagcc ctggtccttc ctgcgcagcc cgggctgggt ccagatcaag tgtgagctcc gagtcctctg ctgctttgcc ttcagcctct cccaggactg ggagctccct gcgaagagag aggcgcagca gcccctgaag gagggcgtcc gggacatgct ggtgaagcac cacctcttca gctgggatgt ggacgggtga. It is sometimes possible for the material contained within the vial of "SGSM3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
