Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SFTPD cdna clone

SFTPD cDNA Clone

Gene Names
SFTPD; SP-D; PSP-D; SFTP4; COLEC7
Synonyms
SFTPD; SFTPD cDNA Clone; SFTPD cdna clone
Ordering
For Research Use Only!
Sequence
atgctgctcttcctcctctctgcactggtcctgctcacacagcccctgggctacctggaagcaggaatgaagacctactcccacagaacaatgcccagtgcttgcaccctggtcatgtgtagctcagtggagagtggcctgcctggtcgcgatggacgggatgggagagagggccctcggggcgagaagggggacccaggtttgccaggagctgcagggcaagcagggatgcctggacaagctggcccagttgggcccaaaggggacaatggctctgttggagaacctggaccaaagggagacactgggccaagtggacctccaggacctcccggtgtgcctggtccagctggaagagaaggtcccctggggaagcaggggaacataggacctcagggcaagccaggcccaaaaggagaagctgggcccaaaggagaagtaggtgccccaggcatgcagggctcggcaggggcaagaggcctcgcaggccctaagggagagcgaggtgtccctggtgagcgtggagtccctggaaacacaggggcagcagggtctgctggagccatgggtccccagggaagtccaggtgccaggggacccccgggattgaagggggacaaaggcattcctggagacaaaggagcaaagggagaaagtgggcttccagatgttgcttctctgaggcagcaggttgaggccttacagggacaagtacagcacctccaggctgctttctctcagtataagaaagttgagctcttcccaaatggccaaagtgtcggggagaagattttcaagacagcaggctttgtaaaaccatttacggaggcacagctgctgtgcacacaggctggtggacagttggcctctccacgctctgccgctgagaatgccgccttgcaacagctggtcgtagctaagaacgaggctgctttcctgagcatgactgattccaagacagagggcaagttcacctaccccacaggagagtccctggtctattccaactgggccccagggaagcccaacgatgatggcgggtcagaggactgtgtggagatcttcaccaatggcaagtggaatgacagggcttgtggagaaaagcgtcttgtggtctgcgagttctga
Sequence Length
1128
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,728 Da
NCBI Official Full Name
Homo sapiens surfactant protein D, mRNA
NCBI Official Synonym Full Names
surfactant protein D
NCBI Official Symbol
SFTPD
NCBI Official Synonym Symbols
SP-D; PSP-D; SFTP4; COLEC7
NCBI Protein Information
pulmonary surfactant-associated protein D
UniProt Protein Name
Pulmonary surfactant-associated protein D
UniProt Gene Name
SFTPD
UniProt Synonym Gene Names
COLEC7; PSPD; SFTP4; PSP-D; SP-D
UniProt Entry Name
SFTPD_HUMAN

NCBI Description

The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism. [provided by RefSeq, Jul 2015]

Uniprot Description

SFTPD: Contributes to the lung's defense against inhaled microorganisms. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties. Belongs to the SFTPD family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 10q22.2-q23.1

Cellular Component: clathrin-coated endocytic vesicle; endocytic vesicle; endoplasmic reticulum membrane; extracellular region; lamellar body; lysosome

Molecular Function: carbohydrate binding; protein binding

Biological Process: alveolus development; cellular protein metabolic process; defense response to bacterium; innate immune response; macrophage chemotaxis; negative regulation of interleukin-2 biosynthetic process; negative regulation of T cell proliferation; positive regulation of phagocytosis; receptor-mediated endocytosis; regulation of immune response; surfactant homeostasis

Research Articles on SFTPD

Similar Products

Product Notes

The SFTPD sftpd (Catalog #AAA1278688) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctct tcctcctctc tgcactggtc ctgctcacac agcccctggg ctacctggaa gcaggaatga agacctactc ccacagaaca atgcccagtg cttgcaccct ggtcatgtgt agctcagtgg agagtggcct gcctggtcgc gatggacggg atgggagaga gggccctcgg ggcgagaagg gggacccagg tttgccagga gctgcagggc aagcagggat gcctggacaa gctggcccag ttgggcccaa aggggacaat ggctctgttg gagaacctgg accaaaggga gacactgggc caagtggacc tccaggacct cccggtgtgc ctggtccagc tggaagagaa ggtcccctgg ggaagcaggg gaacatagga cctcagggca agccaggccc aaaaggagaa gctgggccca aaggagaagt aggtgcccca ggcatgcagg gctcggcagg ggcaagaggc ctcgcaggcc ctaagggaga gcgaggtgtc cctggtgagc gtggagtccc tggaaacaca ggggcagcag ggtctgctgg agccatgggt ccccagggaa gtccaggtgc caggggaccc ccgggattga agggggacaa aggcattcct ggagacaaag gagcaaaggg agaaagtggg cttccagatg ttgcttctct gaggcagcag gttgaggcct tacagggaca agtacagcac ctccaggctg ctttctctca gtataagaaa gttgagctct tcccaaatgg ccaaagtgtc ggggagaaga ttttcaagac agcaggcttt gtaaaaccat ttacggaggc acagctgctg tgcacacagg ctggtggaca gttggcctct ccacgctctg ccgctgagaa tgccgccttg caacagctgg tcgtagctaa gaacgaggct gctttcctga gcatgactga ttccaagaca gagggcaagt tcacctaccc cacaggagag tccctggtct attccaactg ggccccaggg aagcccaacg atgatggcgg gtcagaggac tgtgtggaga tcttcaccaa tggcaagtgg aatgacaggg cttgtggaga aaagcgtctt gtggtctgcg agttctga. It is sometimes possible for the material contained within the vial of "SFTPD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.