SFT2D2 cdna clone
SFT2D2 cDNA Clone
Gene Names
SFT2D2; UNQ512; dJ747L4.C1.2
Synonyms
SFT2D2; SFT2D2 cDNA Clone; SFT2D2 cdna clone
Sequence
atggacaagctgaagaaggtgctgagcgggcaggacacggaggaccggagcggcctgtccgaggttgttgaggcatcttcattaagctggagtaccaggataaaaggcttcattgcgtgttttgctataggaattctctgctcactgctgggtactgttctgctgtgggtgcccaggaagggactacacctcttcgcagtgttttatacctttggtaatatcgcatcaattgggagtaccatcttcctcatgggaccagtgaaacagctgaagcgaatgtttgagcctactcgtttgattgcaactatcatggtgctgttgtgttttgcacttaccctgtgttctgccttttggtggcataacaagggacttgcacttatcttctgcattttgcagtctttggcattgacgtggtacagcctttccttcataccatttgcaagggatgctgtgaagaagtgttttgccgtgtgtcttgcataa
Sequence Length
483
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
17,779 Da
NCBI Official Full Name
Homo sapiens SFT2 domain containing 2, mRNA
NCBI Official Synonym Full Names
SFT2 domain containing 2
NCBI Official Symbol
SFT2D2
NCBI Official Synonym Symbols
UNQ512; dJ747L4.C1.2
NCBI Protein Information
vesicle transport protein SFT2B
UniProt Protein Name
Vesicle transport protein SFT2B
Protein Family
UniProt Gene Name
SFT2D2
UniProt Entry Name
SFT2B_HUMAN
Uniprot Description
SFT2D2: May be involved in fusion of retrograde transport vesicles derived from an endocytic compartment with the Golgi complex. Belongs to the SFT2 family.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1q24.2
Cellular Component: membrane
Biological Process: vesicle-mediated transport
Research Articles on SFT2D2
Similar Products
Product Notes
The SFT2D2 sft2d2 (Catalog #AAA1265667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacaagc tgaagaaggt gctgagcggg caggacacgg aggaccggag cggcctgtcc gaggttgttg aggcatcttc attaagctgg agtaccagga taaaaggctt cattgcgtgt tttgctatag gaattctctg ctcactgctg ggtactgttc tgctgtgggt gcccaggaag ggactacacc tcttcgcagt gttttatacc tttggtaata tcgcatcaat tgggagtacc atcttcctca tgggaccagt gaaacagctg aagcgaatgt ttgagcctac tcgtttgatt gcaactatca tggtgctgtt gtgttttgca cttaccctgt gttctgcctt ttggtggcat aacaagggac ttgcacttat cttctgcatt ttgcagtctt tggcattgac gtggtacagc ctttccttca taccatttgc aagggatgct gtgaagaagt gttttgccgt gtgtcttgca taa. It is sometimes possible for the material contained within the vial of "SFT2D2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
