Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SETD3 cdna clone

SETD3 cDNA Clone

Gene Names
SETD3; C14orf154
Synonyms
SETD3; SETD3 cDNA Clone; SETD3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtaagaagagtcgagtaaaaactcagaaatctggcactggtgctacagcaactgtgtcaccaaaggaaatcttgaacctgaccagtgagctgctgcagaaatgcagcagtccggcgcctggcccaggaaaagagtgggaagagtatgtgcagatccggactctggttgagaaaatacggaaaaagcaaaaaggtctgtccgttacttttgatggaaaaagagaagattactttcctgatctaatgaaatgggcctctgaaaatggggcttctgtcgagggttttgaaatggttaacttcaaagaagagggctttggtttgagagcaacaagagatatcaaggcagaagaattgtttttatgggttccacgaaaattgctaatgactgttgaatctgctaaaaattcagtgttggggcccttatattctcaagaccgaatccttcaagccatgggaaacatcgcactggcctttcatttgctgtgtgagcgagccagccctaactccttctggcagccctatattcaaaccctccccagtgaatatgacactcctctctactttgaagaagatgaagttcggtatcttcagtccacacaagctatacatgatgtcttcagccagtataaaaacacagctcgacagtacgcctacttctataaagtcatccagacccatcctcatgccaacaaactacccttgaaggattctttcacttacgaggactacaggtgggcagtctcttctgttatgacgaggcaaaaccaaattcccacagaggatggttcccgcgtgaccctggctctgattcctttatgggatatgtgtaaccacaccaacggcctggtaacgacctcttcccctgtgttgtgttga
Sequence Length
879
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,540 Da
NCBI Official Full Name
Homo sapiens SET domain containing 3, mRNA
NCBI Official Synonym Full Names
SET domain containing 3
NCBI Official Symbol
SETD3
NCBI Official Synonym Symbols
C14orf154
NCBI Protein Information
histone-lysine N-methyltransferase setd3
UniProt Protein Name
Histone-lysine N-methyltransferase setd3
UniProt Gene Name
SETD3
UniProt Synonym Gene Names
C14orf154
UniProt Entry Name
SETD3_HUMAN

Uniprot Description

SETD3: Histone methyltransferase that methylates 'Lys-36' of histone H3 (H3K36me). H3 'Lys-36' methylation represents a specific tag for epigenetic transcriptional activation. Belongs to the SETD3 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase, protein lysine; Methyltransferase; EC 2.1.1.43

Chromosomal Location of Human Ortholog: 14q32.2

Cellular Component: nuclear chromatin; nucleoplasm

Molecular Function: histone lysine N-methyltransferase activity (H3-K36 specific); histone lysine N-methyltransferase activity (H3-K4 specific); histone-lysine N-methyltransferase activity; transcription coactivator activity

Biological Process: histone H3-K36 methylation; histone H3-K4 methylation; peptidyl-lysine di-methylation; peptidyl-lysine mono-methylation; peptidyl-lysine tri-methylation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent

Research Articles on SETD3

Similar Products

Product Notes

The SETD3 setd3 (Catalog #AAA1266109) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaaga agagtcgagt aaaaactcag aaatctggca ctggtgctac agcaactgtg tcaccaaagg aaatcttgaa cctgaccagt gagctgctgc agaaatgcag cagtccggcg cctggcccag gaaaagagtg ggaagagtat gtgcagatcc ggactctggt tgagaaaata cggaaaaagc aaaaaggtct gtccgttact tttgatggaa aaagagaaga ttactttcct gatctaatga aatgggcctc tgaaaatggg gcttctgtcg agggttttga aatggttaac ttcaaagaag agggctttgg tttgagagca acaagagata tcaaggcaga agaattgttt ttatgggttc cacgaaaatt gctaatgact gttgaatctg ctaaaaattc agtgttgggg cccttatatt ctcaagaccg aatccttcaa gccatgggaa acatcgcact ggcctttcat ttgctgtgtg agcgagccag ccctaactcc ttctggcagc cctatattca aaccctcccc agtgaatatg acactcctct ctactttgaa gaagatgaag ttcggtatct tcagtccaca caagctatac atgatgtctt cagccagtat aaaaacacag ctcgacagta cgcctacttc tataaagtca tccagaccca tcctcatgcc aacaaactac ccttgaagga ttctttcact tacgaggact acaggtgggc agtctcttct gttatgacga ggcaaaacca aattcccaca gaggatggtt cccgcgtgac cctggctctg attcctttat gggatatgtg taaccacacc aacggcctgg taacgacctc ttcccctgtg ttgtgttga. It is sometimes possible for the material contained within the vial of "SETD3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.