SERTAD4 cdna clone
SERTAD4 cDNA Clone
Gene Names
SERTAD4; DJ667H12.2
Synonyms
SERTAD4; SERTAD4 cDNA Clone; SERTAD4 cdna clone
Sequence
atgactctggttctgtccatgaatagattctgcgagcccattgtctcggaaggagctgctgaaattgctgggtaccaaacactatgggaggctgacagctacggaggcccaagccccccagggccagcacaagctcctttgcagggagaccggggagctggtcccccactggcaggatcacattacaggggaatttcaaatcctataacaacatccaagatcacatactttaagaggaagtatgtggaagaagaggattttcacccaccactcagcagctgtagccataaaaccatctcaatttttgaggaacgagcccacatcctttatatgtccttagaaaagctaaagtttatcgatgatcctgaagtgtacctccgaagatctgtccttataaacaatttgatgaaaaggatccatggagaaattatcatgcagaataactggtgcttccctgcctgctctttcaatggcacctctgcccaagagtggtttatggctcaagactgcccttaccgaaaacgaccacggatggccaaagaggaatgtgaaaagtttcatgcctgctgcttttaccaagaatgtggtggccactacctaaatttacccctttctgtcaatgctaatgttggaagtgcctccactgctgcctcctctccctccgcctcttcttcctcctcatcttcctcttcctctccccctttgcctttaccgagttgttcccgccaggtggattttgatgtaggtagtgcatctatttacaagagtgatggccagatacctgccaatgaaatctttgtcactaatgtcagatcacttggtgttcaggaaaaggccaaattaaatgatgagaaagcaaatgatgacaccaacagagatggtggccccctcagccacgaacctgtgggaaatgaccttgcttttgagtgcaaaggccaattttatgattattttgagaccggatataatgaaagaaacaatgtaaatgaatcttggaaaaagtccttacggaaaaaggaggcttcaccaccaagtaacaaactgtgctgcagcaaaggaagtaaaatatga
Sequence Length
1071
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,348 Da
NCBI Official Full Name
Homo sapiens SERTA domain containing 4, mRNA
NCBI Official Synonym Full Names
SERTA domain containing 4
NCBI Official Symbol
SERTAD4
NCBI Official Synonym Symbols
DJ667H12.2
NCBI Protein Information
SERTA domain-containing protein 4
UniProt Protein Name
SERTA domain-containing protein 4
Protein Family
UniProt Gene Name
SERTAD4
UniProt Entry Name
SRTD4_HUMAN
Uniprot Description
SERTAD4:
Chromosomal Location of Human Ortholog: 1q32.1-q41
Similar Products
Product Notes
The SERTAD4 sertad4 (Catalog #AAA1270074) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactctgg ttctgtccat gaatagattc tgcgagccca ttgtctcgga aggagctgct gaaattgctg ggtaccaaac actatgggag gctgacagct acggaggccc aagcccccca gggccagcac aagctccttt gcagggagac cggggagctg gtcccccact ggcaggatca cattacaggg gaatttcaaa tcctataaca acatccaaga tcacatactt taagaggaag tatgtggaag aagaggattt tcacccacca ctcagcagct gtagccataa aaccatctca atttttgagg aacgagccca catcctttat atgtccttag aaaagctaaa gtttatcgat gatcctgaag tgtacctccg aagatctgtc cttataaaca atttgatgaa aaggatccat ggagaaatta tcatgcagaa taactggtgc ttccctgcct gctctttcaa tggcacctct gcccaagagt ggtttatggc tcaagactgc ccttaccgaa aacgaccacg gatggccaaa gaggaatgtg aaaagtttca tgcctgctgc ttttaccaag aatgtggtgg ccactaccta aatttacccc tttctgtcaa tgctaatgtt ggaagtgcct ccactgctgc ctcctctccc tccgcctctt cttcctcctc atcttcctct tcctctcccc ctttgccttt accgagttgt tcccgccagg tggattttga tgtaggtagt gcatctattt acaagagtga tggccagata cctgccaatg aaatctttgt cactaatgtc agatcacttg gtgttcagga aaaggccaaa ttaaatgatg agaaagcaaa tgatgacacc aacagagatg gtggccccct cagccacgaa cctgtgggaa atgaccttgc ttttgagtgc aaaggccaat tttatgatta ttttgagacc ggatataatg aaagaaacaa tgtaaatgaa tcttggaaaa agtccttacg gaaaaaggag gcttcaccac caagtaacaa actgtgctgc agcaaaggaa gtaaaatatg a. It is sometimes possible for the material contained within the vial of "SERTAD4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
