Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINH1 cdna clone

SERPINH1 cDNA Clone

Gene Names
SERPINH1; CBP1; CBP2; OI10; gp46; AsTP3; HSP47; PIG14; PPROM; RA-A47; SERPINH2
Synonyms
SERPINH1; SERPINH1 cDNA Clone; SERPINH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgctccctcctgcttctcagcgccttctgcctcctggaggcggccctggccgccgaggtgaagaaacctgcagccgcagcagctcctggcactgcggagaagttgagccccaaggcggccacgcttgccgagcgcagcgccggcctggccttcagcttgtaccaggccatggccaaggaccaggcagtggagaacatcctggtgtcacccgtggtggtggcctcgtcgctggggctcgtgtcgctgggcggcaaggcgaccacggcgtcgcaggccaaggcagtgctgagcgccgagcagctgcgcgacgaggaggtgcacgccggcctgggcgagctgctgcgctcactcagcaactccacggcgcgcaacgtgacctggaagctgggcagccgactgtacggacccagctcagtgagcttcgctgatgacttcgtgcgcagcagcaagcagcactacaactgcgagcactccaagatcaacttccgcgacaagcgcagcgcgctgcagtccatcaacgagtgggccgcgcagaccaccgacggcaagctgcccgaggtcaccaaggacgtggagcgcacggacggcgccctgttagtcaacgccatgttcttcaagccacactgggatgagaaattccaccacaagatggtggacaaccgtggcttcatggtgactcggtcctataccgtgggtgtcatgatgatgcaccggacaggcctctacaactactacgacgacgagaaggaaaagctgcaaatcgtggagatgcccctggcccacaagctctccagcctcatcatcctcatgccccatcacgtggagcctctcgagcgccttgaaaagctgctaaccaaagagcagctgaagatctggatggggaagatgcagaagaaggctgttgccatctccttgcccaagggtgtggtggaggtgacccatgacctgcagaaacacctggctgggctgggcctgactgaggccattgacaagaacaaggccgacttgtcacgcatgtcaggcaagaaggacctgtacctggccagcgtgttccacgccaccgcctttgagttggacacagatggcaacccctttgaccaggacatctacgggcgcgaggagctgcgcagccccaagctgttctacgccgaccaccccttcatcttcctagtgcgggacacccaaagcggctccctgctattcattgggcgcctggtccggcctaagggtgacaagatgcgagacgagttatag
Sequence Length
1257
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
871
Molecular Weight
46,441 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1), mRNA
NCBI Official Synonym Full Names
serpin family H member 1
NCBI Official Symbol
SERPINH1
NCBI Official Synonym Symbols
CBP1; CBP2; OI10; gp46; AsTP3; HSP47; PIG14; PPROM; RA-A47; SERPINH2
NCBI Protein Information
serpin H1
UniProt Protein Name
Serpin H1
Protein Family
UniProt Gene Name
SERPINH1
UniProt Synonym Gene Names
CBP1; CBP2; HSP47; SERPINH2; AsTP3; Colligin
UniProt Entry Name
SERPH_HUMAN

NCBI Description

This gene encodes a member of the serpin superfamily of serine proteinase inhibitors. The encoded protein is localized to the endoplasmic reticulum and plays a role in collagen biosynthesis as a collagen-specific molecular chaperone. Autoantibodies to the encoded protein have been found in patients with rheumatoid arthritis. Expression of this gene may be a marker for cancer, and nucleotide polymorphisms in this gene may be associated with preterm birth caused by preterm premature rupture of membranes. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, May 2011]

Uniprot Description

SERPINH1: Binds specifically to collagen. Could be involved as a chaperone in the biosynthetic pathway of collagen. Defects in SERPINH1 are the cause of osteogenesis imperfecta type 10 (OI10). A connective tissue disorder characterized by bone fragility, low bone mass, bowing of limbs due to multiple fractures, short limb dwarfism and blue sclerae. Belongs to the serpin family.

Chromosomal Location of Human Ortholog: 11q13.5

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; ER-Golgi intermediate compartment; extracellular space; lipid raft

Molecular Function: collagen binding

Biological Process: collagen fibril organization; response to unfolded protein

Disease: Osteogenesis Imperfecta, Type X; Preterm Premature Rupture Of The Membranes

Research Articles on SERPINH1

Similar Products

Product Notes

The SERPINH1 serpinh1 (Catalog #AAA1271818) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgctccc tcctgcttct cagcgccttc tgcctcctgg aggcggccct ggccgccgag gtgaagaaac ctgcagccgc agcagctcct ggcactgcgg agaagttgag ccccaaggcg gccacgcttg ccgagcgcag cgccggcctg gccttcagct tgtaccaggc catggccaag gaccaggcag tggagaacat cctggtgtca cccgtggtgg tggcctcgtc gctggggctc gtgtcgctgg gcggcaaggc gaccacggcg tcgcaggcca aggcagtgct gagcgccgag cagctgcgcg acgaggaggt gcacgccggc ctgggcgagc tgctgcgctc actcagcaac tccacggcgc gcaacgtgac ctggaagctg ggcagccgac tgtacggacc cagctcagtg agcttcgctg atgacttcgt gcgcagcagc aagcagcact acaactgcga gcactccaag atcaacttcc gcgacaagcg cagcgcgctg cagtccatca acgagtgggc cgcgcagacc accgacggca agctgcccga ggtcaccaag gacgtggagc gcacggacgg cgccctgtta gtcaacgcca tgttcttcaa gccacactgg gatgagaaat tccaccacaa gatggtggac aaccgtggct tcatggtgac tcggtcctat accgtgggtg tcatgatgat gcaccggaca ggcctctaca actactacga cgacgagaag gaaaagctgc aaatcgtgga gatgcccctg gcccacaagc tctccagcct catcatcctc atgccccatc acgtggagcc tctcgagcgc cttgaaaagc tgctaaccaa agagcagctg aagatctgga tggggaagat gcagaagaag gctgttgcca tctccttgcc caagggtgtg gtggaggtga cccatgacct gcagaaacac ctggctgggc tgggcctgac tgaggccatt gacaagaaca aggccgactt gtcacgcatg tcaggcaaga aggacctgta cctggccagc gtgttccacg ccaccgcctt tgagttggac acagatggca acccctttga ccaggacatc tacgggcgcg aggagctgcg cagccccaag ctgttctacg ccgaccaccc cttcatcttc ctagtgcggg acacccaaag cggctccctg ctattcattg ggcgcctggt ccggcctaag ggtgacaaga tgcgagacga gttatag. It is sometimes possible for the material contained within the vial of "SERPINH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.