Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINE2 cdna clone

SERPINE2 cDNA Clone

Gene Names
SERPINE2; GDN; PI7; PN1; PNI; PI-7; PN-1; GDNPF
Synonyms
SERPINE2; SERPINE2 cDNA Clone; SERPINE2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactggcatctccccctcttcctcttggcctctgtgacgctgccttccatctgctcccacttcaatcctctgtctctcgaggaactaggctccaacacggggatccaggttttcaatcagattgtgaagtcgaggcctcatgacaacatcgtgatctctccccatgggattgcgtcggtcctggggatgcttcagctgggggcggacggcaggaccaagaagcagctcgccatggtgatgagatacggcgtaaatggagttggtaaaatattaaagaagatcaacaaggccatcgtctccaagaagaataaagacattgtgacagtggctaacgccgtgtttgttaagaatgcctctgaaattgaagtgccttttgttacaaggaacaaagatgtgttccagtgtgaggtccggaatgtgaactttgaggatccagcctctgcctgtgattccatcaatgcatgggttaaaaatgaaaccagggatatgattgacaatctgctgtccccagatcttattgatggtgtgctcaccagactggtcctcgtcaacgcagtgtatttcaagggtctgtggaaatcacggttccaacccgagaacacaaagaaacgcactttcgtggcagccgacgggaaatcctatcaagtgccaatgctggcccagctctccgtgttccggtgtgggtcgacaagtgcccccaatgatttatggtacaacttcattgaactgccctaccacggggaaagcatcagcatgctgattgcactgccgactgagagctccactccgctgtctgccatcatcccacacatcagcaccaagaccatagacagctggatgagcatcatggtgcccaagagggtgcaggtgatcctgcccaagttcacagctgtagcacaaacagatttgaaggagccgctgaaagttcttggcattactgacatgtttgattcatcaaaggcaaattttgcaaaaataacaaggtcagaaaacctccatgtttctcatatcttgcaaaaagcaaaaattgaagtcagtgaagatggaaccaaagcttcagcagcaacaactgcaattctcattgcaagatcatcgcctccctggtttatagtagacagaccttttctgtttttcatccgacataatcctacaggtgctgtgttattcatggggcagataaacaaaccctga
Sequence Length
1194
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,267 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2, mRNA
NCBI Official Synonym Full Names
serpin family E member 2
NCBI Official Symbol
SERPINE2
NCBI Official Synonym Symbols
GDN; PI7; PN1; PNI; PI-7; PN-1; GDNPF
NCBI Protein Information
glia-derived nexin
UniProt Protein Name
Glia-derived nexin
Protein Family
UniProt Gene Name
SERPINE2
UniProt Synonym Gene Names
PI7; PN1; GDN; PI-7; PN-1
UniProt Entry Name
GDN_HUMAN

NCBI Description

This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

Uniprot Description

SERPINE2: Serine protease inhibitor with activity toward thrombin, trypsin, and urokinase. Promotes neurite extension by inhibiting thrombin. Binds heparin. Belongs to the serpin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Inhibitor; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 2q36.1

Cellular Component: cytosol; extracellular matrix; extracellular region; extracellular space; extrinsic to external side of plasma membrane; neuromuscular junction

Molecular Function: glycosaminoglycan binding; heparin binding; protein binding; receptor binding; serine-type endopeptidase inhibitor activity

Biological Process: blood coagulation; negative regulation of blood coagulation; negative regulation of proteolysis; positive regulation of astrocyte differentiation

Research Articles on SERPINE2

Similar Products

Product Notes

The SERPINE2 serpine2 (Catalog #AAA1268764) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactggc atctccccct cttcctcttg gcctctgtga cgctgccttc catctgctcc cacttcaatc ctctgtctct cgaggaacta ggctccaaca cggggatcca ggttttcaat cagattgtga agtcgaggcc tcatgacaac atcgtgatct ctccccatgg gattgcgtcg gtcctgggga tgcttcagct gggggcggac ggcaggacca agaagcagct cgccatggtg atgagatacg gcgtaaatgg agttggtaaa atattaaaga agatcaacaa ggccatcgtc tccaagaaga ataaagacat tgtgacagtg gctaacgccg tgtttgttaa gaatgcctct gaaattgaag tgccttttgt tacaaggaac aaagatgtgt tccagtgtga ggtccggaat gtgaactttg aggatccagc ctctgcctgt gattccatca atgcatgggt taaaaatgaa accagggata tgattgacaa tctgctgtcc ccagatctta ttgatggtgt gctcaccaga ctggtcctcg tcaacgcagt gtatttcaag ggtctgtgga aatcacggtt ccaacccgag aacacaaaga aacgcacttt cgtggcagcc gacgggaaat cctatcaagt gccaatgctg gcccagctct ccgtgttccg gtgtgggtcg acaagtgccc ccaatgattt atggtacaac ttcattgaac tgccctacca cggggaaagc atcagcatgc tgattgcact gccgactgag agctccactc cgctgtctgc catcatccca cacatcagca ccaagaccat agacagctgg atgagcatca tggtgcccaa gagggtgcag gtgatcctgc ccaagttcac agctgtagca caaacagatt tgaaggagcc gctgaaagtt cttggcatta ctgacatgtt tgattcatca aaggcaaatt ttgcaaaaat aacaaggtca gaaaacctcc atgtttctca tatcttgcaa aaagcaaaaa ttgaagtcag tgaagatgga accaaagctt cagcagcaac aactgcaatt ctcattgcaa gatcatcgcc tccctggttt atagtagaca gaccttttct gtttttcatc cgacataatc ctacaggtgc tgtgttattc atggggcaga taaacaaacc ctga. It is sometimes possible for the material contained within the vial of "SERPINE2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.